Molecular Phylogenetics and Evolution 53 (2009) 620-630 ELSEVIER Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev '? '% m Multilocus molecular phylogenetic analysis of the montane Craugastor podiciferus species complex (Anura: Craugastoridae) in Isthmian Central America Jeffrey W. Stretcher"*'*, Andrew J. Crawfordcl, Cody W. Edwardsb "Department of Molecular and Microbiology, George Mason University, Fairfax, VA 22030, USA b Department of Environmental Science and Policy, George Mason University, Fairfax, VA 22030, USA c Smithsonian Tropical Research Institute, MRC 0580-08, Apartado 0843-03092, Panama ARTICLE INFO Article history: Received 17 February 2009 Revised 4 July 2009 Accepted 7 July 2009 Available online 12 July 2009 Keywords: Brachycephalidae Eleutherodactylus Terrarana Phylogeography 12S 16S COI c-myc ABSTRACT The Craugastor podiciferus complex is a group of phenotypically polymorphic direct-developing frogs that inhabit the Talamancan highlands of Costa Rica and Panama. The montane distribution of this group cre- ates natural allopatry among members and offers an excellent opportunity to explore geographic models of speciation. Using a multilocus approach, we obtained data from one nuclear (c-myc) and three mito- chondria! (12S, 16S, and COI) gene regions from 40 individuals within the C. podiciferus complex. Molec- ular phylogenetic analyses revealed a basal split that placed samples from western Panama as sister to Costa Rican (CR) samples, corroborating a previous suggestion that the former lineage may represent an undescribed species. Within the CR clades we found six distinct haplogroups whose distributions lar- gely corresponded to geographic features and included instances of sympatry. Divergence estimates were used to develop a preliminary evolutionary timeframe for the diversification of the C podiciferus complex. Based on collective evidence, we hypothesize that movement of the CR haplogroups has occurred between currently isolated areas of suitable habitat via second order climatic fluctuations during the Pleistocene. The levels of genetic differentiation within the C. podiciferus complex are remarkable given the relatively small geographic area (ca. 8000 km2) of occurrence. This diversity emphasizes the need for further study and taxonomic revision to aid in conservation planning for this complex which, like many amphibians, has experienced recent population declines. ? 2009 Elsevier Inc. All rights reserved. 1. Introduction Tropical montane forests are known to harbor large numbers of species relative to their temperate analogs and are considered hot- spots of biodiversity. In addition to acting as more effective barri- ers to organismal dispersal (Janzen, 1967; Ghalambor et al., 2006), tropical mountains have been shown to contain the highest levels of species richness for a wide range of taxa (Kessler and Kluge, 2008). Elucidating various aspects of this diversity, such as cryptic species and the degree of endemism, is critical in the understand- ing and formation of geographic models of speciation for these montane tropical regions. In Central America (here defined as south of Mexico and northwest of Colombia), studies of genetic diversity among widely distributed montane taxa are available for most vertebrate groups (e.g., mammals, Arellano et al., 2003; * Corresponding author. Present address: Amphibian and Reptile Diversity Research Center, Department of Biology, The University of Texas at Arlington, Arlington, TX 76019, USA. Fax: +1 817 272 2855. E-mail address: streicher@uta.edu (J.W. Streicher). 1 Departamento de Ciencias Bioldgicas, Universidad de los Andes, A.A. 4976, Bogota, Colombia. 1055-7903/$ - see front matter ? 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2009.07.011 reptiles, Castoe et al., 2005; birds, Cadena et al. 2007; amphibians; Wiens et al., 2007). However, there are few well-sampled molecu- lar studies on the phylogenetic relationships of vertebrates ende- mic to particular regions and specifically the mountains of Isthmian Central America (here defined as Costa Rica and Panama) (e.g., Hafner, 1991; Garcia-Paris et al., 2000). The highlands of Costa Rica and western Panama, i.e., the Tila- ran, Central, and Talamancan mountain chains, are known to con- tain unique floral and faunal assemblages (Olson et al., 2001). These Cordilleran uplands share a dynamic and recent geologic his- tory, which has created an archipelago-like separation of habitat in this ecoregion (Talamancan montane forest [TMF] Fig. 1; Denyer et al., 2000; Olson et al., 2001). While the TMF currently covers ele- vations of 700-3000 m, evidence from paleoecological studies of montane oak species (Quercus) from Panama indicate that the loca- tion of this ecoregion has shifted throughout time (Colinvaux, 1991). These historical shifts have been driven by climatic fluctua- tions lowering components of the ecoregion as much as 1000 m during glacial periods in which local temperatures decreased by 4?C (Colinvaux et al., 1996; Piperno and Pearsall, 1998). In light of this, distributional patterns of many biota endemic to the moun- tains of Central America are thought to have been driven by glacial J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 621 Fig. 1. Geographic locations of sampling sites (locality ID; Table 1) and simplified overlay of Craugastor podiciferus complex cladogram in Costa Rica and Panama. Barred areas represent zones of sympatry between Clades A-G. Geopolitical boundary between Costa Rica (CR) and Panama (PA) is indicated by a dashed line. Shaded areas represent a variety of montane habitats ranging in elevation from 750-3000 m. which are collectively referred to as the Talamancan montane forest ecoregion. cycles where presently isolated segments of habitat became tem- porarily connected during periods of global cooling (Savage, 2002). Among vertebrates found in this ecoregion, amphibians offer ideal systems for studying phylogeography on a small spatial scale in that: (1) they occur in a relatively heterogeneous environment created by variable elevations and fragmented topography and (2) they are generally poor dispersers, often locally abundant, and easily studied (Crawford, 2003a; Beebee, 2005). Although amphibian species composition in these Isthmian mountains is rel- atively well known (Campbell, 1999; Savage, 2002) our under- standing of the phylogeographic relationships within these species is not. Previous molecular studies on montane bolitoglos- sine salamanders from this region have revealed extremely high levels of genetic diversity across a relatively small geographic area (Garcia-Paris et at., 2000; Wiens et al., 2007) hinting that levels of diversity in these uplands may mirror the high genetic diversity described for lowland amphibians in the region (e.g., Crawford, 2003a; Weigt et al., 2005; Crawford et al., 2007; Wang et al., 2008). To our knowledge, no molecular study has extensively examined the intraspecific relationships of any anuran species that is restricted to the highlands of Costa Rica and western Panama, despite >20 frog and toad species sharing this distribution (Savage, 2002). The Cerro Utyum robber frog, Craugastor podiciferus (Anura: Craugastoridae; Hedges et al., 2008), is a diminutive (21-40 mm) locally abundant member of the leaf litter fauna found at eleva- tions of 1090-2650 m throughout the TMF ecoregion (Savage, 2002). Owing to many isolated populations and phenotypic poly- morphism, the species is thought to be polytypic (Savage, 2002) and we therefore refer to it as the C. podiciferus complex. Consider- ing its distribution and abundance, this complex represents a un- ique opportunity to characterize biogeographic patterns in an ecoregion with a dynamic history of geologic uplift and climatic fluctuation. A concomitant motivation to study the phylogenetics of the C. podiciferus complex is that, like most highland amphibians of Central America, it has recently experienced unprecedented population declines (Pounds and Crump, 1994; Lips, 1999; Pus- chendorf et al., 2006) and is red-listed for conservation by The World Conservation Union (IUCN, 2006). This necessitates a strengthened taxonomic understanding of the group to aid with future conservation and management decisions. The goals of this study were as follows: (1) assess the levels of genetic differ- entiation within the C. podiciferus complex, (2) evaluate the phylo- geography of its members by examining individuals from geographically distinct regions using mitochondrial (mtDNA) and nuclear (scnDNA) DMA markers, and (3) suggest a possible histor- ical framework for vicariance and dispersal mechanisms among lineages within this species complex. 2. Materials and methods 2.7. Study system A recent taxonomic revision (Hedges et al., 2008) has divided the nominal genus Eieutherodactylus (and related genera) into sev- eral families that collectively form a clade now known as Terrar- ana. The genus Craugastor is within this clade and contains >110 described species of direct-developing anurans ranging from the southwestern United States to northern South America (Crawford and Smith, 2005). The C. podiciferus complex is contained within the C. podiciferus species group (Hedges et al., 2008) which is re- nowned for extreme phenotypic polymorphism within species and within populations (Savage and Emerson, 1970). Due in part to the shared color pattern polymorphisms, systematic work on the C. podiciferus species group has been limited (Cope, 1875; Tay- lor, 1952; Savage and Emerson, 1970; Miyamato, 1983). Recent studies have supported the hypothesis that the C. podiciferus com- plex may contain multiple taxa; Chen (2005) noted significant chromosomal variation within C. podiciferus, and Crawford and Smith (2005) documented significant mitochondrial and nuclear sequence divergence between just two populations. While both studies provided evidence of cryptic diversity, the small number of samples and localities included (N < 4) were insufficient to char- acterize the true geographic and phylogenetic extent of the poten- tial diversity within the C. podiciferus complex. 2.2. Taxon sampling Tissue samples were collected from 40 C. podiciferus complex frogs from 12 sites in Costa Rica and Panama (Table 1). This sampling includes representatives from the Talamanca, Tilaran, 622 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 Table 1 Institutional voucher numbers, locality information, and GenBank accession numbers for sampled taxa. Taxon and institutional voucher3 Locality ID Collection locality'' Geographic coordinates/ approximate location Elevation (m) GenBank accession number 12S 16S CO! c-myc Genus Craugastor podiciferus group C cf. podiciferus l.UTAA-52449 1 Puntarenas, CR (10?18'N, 84?48'W) 1520 EF562312 EF562365 None EF562417 2. MVZ 149813 2 Puntarenas, CR (10?18'N, 84?42'W) 1500 EF562319 EF562373 EF562386 EF562430 3. FMNH 257669 Puntarenas, CR (10?18'N, 84?47'W) 1500 EF562320 EF562372 EF562380 EF562432 4. FMNH 257670 Puntarenas, CR (10?18'N, 84?47'W) 1500 EF562317 EF562336 EF562376 EF562421 5. FMNH 257671 Puntarenas, CR (10?18'N, 84?47'W) 1500 EF562314 EF562374 EF562409 None 6. FMNH 257672 Puntarenas, CR (10?18'N, 84?47'W) 1500 EF562318 None EF562382 None 7. FMNH 257673 Puntarenas, CR (10?18'N, 84?47'W) 1500 EF562311 EF562343 EF562392 None 8. UCR 16361 3 Alejuela, CR (10?13'N, 84?22'W) 1930 EF562321 EF562371 EF562375 EF562431 9. UCR 16353 4 Heredia, CR (10?12'N, 84?09'W) 1500 EF562313 EF562349 None EF562420 10. UCR 16354 4 Heredia, CR (10?12'N, 84?09'W) 1500 EF562315 EF562363 None EF562418 11, UCR 16355 4 Heredia, CR (10?12'N, 84?09'W) 1500 EF562316 EF562366 None EF562419 12, UCR 18062 6 Heredia, CR (10?10'N, 84?06'W) 1900 EF562302 EF562342 EF562395 None 13. UCR 17439 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562298 EF562341 EF562387 EF562427 14. UCR 17441 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562299 EF562345 EF562388 EF562429 15. UCR 17442 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562300 EF562337 EF562385 EF562422 16. UCR 17443 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562301 EF562340 EF562384 EF562428 17. UCR 17462 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562309 EF562355 EF562406 EF562440 18. UCR 17469 5 Heredia, CR (10?09'N, 84?09'W) 2000 EF562310 EF562334 EF562405 EF562414 19. MVZ 164825 7 Heredia, CR (10? 05'N, 84- 04'W) 2100 EF562303 EF562346 EF562381 EF562423 20. UCR 16357 8 San Jose, CR (10?02'N, 83?57'W) 1600 EF562306 EF562339 EF562400 EF562433 21. UCR 16358 8 San Jose, CR (10?02'N, 83?57'W) 1600 EF562307 EF562370 EF562412 EF562415 22. UCR 16356 8 San Jose, CR (10?01'N, 83?56'W) 1940 EF562308 EF562329 None None 23. UCR 16359 10 San Jose, CR (9?26'N, 83-41'W) 1313 EF562297 EF562369 EF562396 None 24. UCR 16360 10 San Jose, CR (9?26'N, 83?41'W) 1313 EF562296 EF562368 None EF562434 25. FMNH 257595 9 Cartago, CR (9-44'N, 83-46'W) 1600 EF562304 EF562338 EF562408 None 26. FMNH 257596 9 Cartago, CR (9-44'N, 83-46'W) 1600 EF562305 EF562335 None EF562416 27. FMNH 257550 11 Puntarenas, CR (8-47'N, 82-59'W) 1350 EF562294 EF562330 EF562393 EF562443 28. FMNH 257651 11 Puntarenas, CR (8-47'N, 82-59'W) 1350 EF562291 EF562367 EF562402 EF562435 29. FMNH 257652 11 Puntarenas, CR (8-47'N, 82??59'W) 1350 EF562288 EF562364 EF562390 None 30. FMNH 257653 11 Puntarenas, CR (8?47'N, 82?59'W) 1350 EF562292 EF562354 EF562392 EF562438 31. FMNH 257755 11 Puntarenas, CR (8-46'N, 82?59'W) 1410 EF562289 EF562344 EF562379 None 32. FMNH 257756 11 Puntarenas, CR (8-46'N, 82?59'W) 1410 EF562290 EF562347 EF562377 EF562413 33. FMNH 257757 11 Puntarenas, CR (8-46'N, 82?59'W) 1410 EF562293 EF562352 EF562383 EF562437 34. FMNH 257758 11 Puntarenas, CR (8-46'N, 82?59'W) 1410 EF562295 EF562348 EF562397 EF562436 Craugastor sp. A 35. USNM 563039 12 Chiriqui, PA (8-48'N, 82-24'W) 1663 EF562284 EF562356 EF562389 EF562445 36. USNM 563040 12 Chiriqui, PA (8-48'N, 82-24'W) 1663 EF562285 EF562350 EF562391 EF562439 37. AJC 0890 12 Chiriqui, PA (8-48'N, 82?24'W) 1663 EF562282 EF562351 EF562398 EF562444 38. MVUP 1880 12 Chiriqui, PA (8?48'N, 82?24'W) 1663 EF562283 EF562358 EF562399 EF562442 39. FMNH 257689 12 Chiriqui, PA (8-45'N, 82-13'W) 1100 EF562287 EF562353 EF562407 EF562446 40. FMNH 257562 12 Chiriqui, PA (8-45'N, 82-13'W) 1100 EF562286 EF562357 EF562410 EF562441 C underwoodi 41. USNM 561403 N/A Heredia, CR (10-24'N, 84-03'W) 800 EF562323 EF562361 EF562378 None 42. UCR 16315 N/A Alejuela, CR (10-13'N, 84-35'W) 960 EF562322 EF562362 EF562394 None C stejnegerianus * 43. UCR 16332 N/A San Jose, CR (9-18'N, 83-46'W) 900 EF562325 EF562360 EF562411 AY211320 C bransfordii * 44. MVUP 1875 N/A BDT, PA (9-24'N, 82-17'W) 50 EF562324 EF562359 None AY211304 Rtzingeri group C tabasarae 45. MVUP 1720 N/A Code, PA (8-40'N. 80-35'W) 800 EF562326 EF562332 EF562401 EF562424 C cf. longirostris 46. FMNH 257561 N/A Chiriqui, PA (8?45'N, 82?13'W) 1100 EF562327 EF562331 None EF562426 47. FMNH 257678 N/A Chiriqui, PA (8?45'N, 82?13'W) 1100 EF562328 EF562333 EF562404 EF562425 a UTA, University of Texas at Arlington; UCR, Universidad de Costa Rica; USNM, National Museum of Natural History, Smithsonian Institution; FMNH, Field Museum of Natural History; MVZ, Museum of Vertebrate Zoology; MVUP, Museo de Vertebrados de la Universidad de Panama; AJC, Andrew J. Crawford. b CR, Costa Rica; PA, Panama; BDT, Bocas del Toro. Sequence obtained from Crawford and Smith (2005) via GenBank. and Central mountain ranges and therefore spans the known range of this species complex. Frogs were collected in the field, photo- graphed, and euthanized with dilute Chloretone or 10% benzocaine gel. Fresh liver samples were stored in either 95% ethanol or a NaCl-saturated buffer containing 0.25 M EDTA and 20% dimethyl sulphoxide (DMSO; Seutin et al., 1991). Corresponding voucher specimens were fixed in 10% formalin, stored in 70% ethanol (Pisani, 1973), and deposited in biodiversity collections at the fol- lowing public research collections: University of Texas at Arlington (UTA), the Smithsonian Institution's National Museum of Natural History (USNM), Field Museum of Natural History (FMNH), Mu- seum of Vertebrate Zoology (MVZ), Universidad de Costa Rica (UCR), and Museo de Vertebrados de la Universidad de Panama (MVUP). All C. podiciferus complex samples were collected at eleva- J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 623 tions between 1100 and 2600 m. The closely related lowland spe- cies C. bransfordii, C. stejnegerianus, and C. underwoodi were also in- cluded as ingroup taxa based on reports of their close affiliation with the C. podiciferus complex (Lynch, 2000; Savage, 2002; Craw- ford and Smith, 2005). We used three individuals belonging to the C fitzingeri species group as outgroup taxa (one C. tabasarae and two C. cf. longirostris). 2.3. DNA amplification and sequencing We investigated the C. podiciferus complex using DNA se- quences from four genes. Nucleotide sequences from the mito- chondrial 12S ribosomal gene (12S), mitochondrial 16S ribosomal gene (16S), mitochondrial Cytochrome Oxidase I gene (COI) and in- tron two of the nuclear cellular myelocytomatosis gene (c-myc) were identified as phylogenetically informative and incorporated as both separate and concatenated data sets in our analyses. Geno- mic DNA was extracted from liver and thigh muscle using a Qiagen Dneasy kit (QIAGEN?, Valencia, California). DNA fragments were amplified using published primer sets and primers designed for this study (Table 2). Polymerase Chain Reaction (PCR; Saiki et al., 1988) amplification was performed using AmpliTaq Gold? (Ap- plied Biosystems, Foster City, California) and variable thermal cy- cling profiles depending on the target region (detailed below). Reactions were performed in 20 ul reaction volumes containing 2-4 ul of template DNA and 1 ul of 0.1% Bovine Serum Albumin (BSA). Thermal cycling was performed on either a PTC-100 or PTC-200 Peltier Thermal Cycler. The gene regions 12S, 16S, and COI were all PCR amplified using the following parameters: An initial cycle of 95 ?C (11 min) followed by 45 cycles of 95 ?C (30 s) denaturing, 50 or 45 ?C (30 s) annealing, and 72 ?C(2 min) extension. A final phase of 72 ?C (10 min) followed. A region of c-myc including portions of exon 2 and intron 2 was amplified using touchdown PCR (Don et al., 1991) with the following parameters: 95 ?C (11 min) followed by 20 cycles of 95 ?C (30 s) denaturing, 58 ?C (30 s) annealing and 72 ?C (1 min) extension fol- lowed by 3 cycles of 95 ?C (30 s) denaturing, 58 ?C (-1 ?C per cycle) (30 s) annealing, and 72 ?C (1 min) extension followed by 20 cycles of 95 ?C (30 s) denaturing, 55 ?C (30 s) annealing and 72 ?C (1 min) +5 s per cycle extension; a final phase of 72 ?C (10 min) followed. All PCR experiments contained a positive and negative control. PCR products were quantified on either a 1% or 2% TAE agarose gel and cleaned using the AMPure magnetic bead system (Agencourt? Bioscience, Beverly, Massachusetts). Sequencing reactions were performed using the BigDye terminator kit (Applied BioSystems, Foster City, California) and were cleaned using Sephadex? G-50 powder (Sigma-Aldrich, St. Louis, Missouri). DNA sequencing was performed on a multi-capillary genetic analyzer (Spectrumedix?, State College, Pennsylvania). Both directions of PCR product were sequenced directly and their consensus sequence submitted to GenBank (Accession numbers listed in Table 1). 2.4. Phylogenetic analysis Contiguous sequences from overlapping fragments were assem- bled in Sequencher 4.1 (GeneCodes) and multiple sequence align- ments were constructed using Clustal X (Thompson et al., 1997) and checked by eye. For c-myc fragments, heterozygosity was as- sumed if automated sequencing chromatograms contained strong and equal double peaks on both strands or when alternately dom- inant peak height was observed from the two chromatograms (Hare and Palumbi, 1999). Genie structure of the COI fragment was determined via alignment to the Xenopus laevis mitochondrial genome (GenBank Accession No.: NC_001573; Roe et al., 1985) where it corresponded with bases 8138-8645. Sequences were analyzed by individual gene region and as a combined data set. To test for significant phylogenetic heterogeneity between pairs of gene regions, we used an Incongruence Length Difference (ILD) test (Farris et al., 1994) with 2000 iterations as implemented in PAUP* 4.0bl0 (Swofford, 2002). Distance and parsimony-based analyses were also conducted using PAUP* 4.0b 10. Neighbor join- ing (NJ; Saitou and Nei, 1987) trees were constructed using uncor- rected distances. Maximum Parsimony (MP) analysis was conducted under heuristic search criteria using TBR branch swap- ping and 10 random addition sequence replicates with all charac- ters weighted equally and gaps considered missing data. Using parsimony criterion, non-parametric bootstrapping was performed for 2000 replicates (Hedges, 1992) and partitioned Bremer support values (Baker etaL, 1998) were generated using TreeRot 2b (Soren- son, 1999). Since several models of DNA sequence evolution used herein as- sume constant frequency over time and between lineages, likeli- hood-based analyses were preceded with a xi(n-i) test for heterogeneity in base frequency executed in PAUP* 4.0bl0. We employed a Bayesian Information Criterion (BIC) in Modeltest 3.7 (Posada and Crandall, 1998) to select an appropriate model of DNA sequence evolution for each gene individually and the four gene concatenated dataset. In estimating these BIC models, we used the total number of nucleotides in each alignment as a surro- gate for sample size (Posada, 2006). For the concatenated dataset, Bayesian Markov chain Monte Carlo (MCMC) analyses (Yang and Rannala, 1997) were conducted in MrBayes 3.1.2 (Ronquist and Huelsenbeck, 2003) with independent models applied to each data partition (Table 3). Two parallel MCMC runs were conducted over 10 million generations, with sampling occurring every 1000 gener- ations. In order to identify topological convergence in our searches, we used the online program AWTY (Wilgenbusch et al., 2004; Nylander et al., 2008) to compare the MCMC runs. Both runs con- tained four Metropolis-coupled MCMC chains with a default tem- perature parameter of 0.2. For comparison, we also conducted a non-partitioned Bayesian MCMC analysis with the concatenated data set. Due to the large number of mtONA sites relative to scnDNA sites used in this study along with an overall slower mutational rate in Table 2 Primers used in the amplification (amp) and sequencing (seq) of Craugastor genes. Locus Primer Use Reference Sequence (5'-3') 12S 12SF both Bossuyt and Milinkovitch (2000) AAACTGGGATTAGATACCCCACTAT 12S 12SR both Liu et al. (2000) ACACACCGCCCGTCACCCTC 16S 16SAR both Kessinget al. (1989) CGCCTGTTTAYCAAAAACAT 16S 16SBR both Kessinget al. (1989) CCGGTCTGAACTCAGATCACGT COI COIF both Kessinget al. (1989) CCTGCAGGAGGAGGAGAYCC COI COIR both Kessinget al. (1989) AGTATAAGCGTCTGGGTAGTC c-myc cmyclU amp Crawford (2003a) GAGGACATCTGGAARAARTT c-myc cmyc3L amp Crawford (2003a) GTCTTCCTCTTGTCRTTCTCYTC c-myc cmycseqF seq this study TTCTGAATGCATTGACCCTTCGG c-myc cmycseqR seq this study TTCTTCCTCATCTTCGTCTTCATCC 624 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 Table 3 Likelihood ratio test (LRT) statistics for combined mtDNA and four individual gene regions in Craugastor. Note that while several genes reject a molecular clock when applied to all samples (significant values indicated with an *), all genie regions fail to reject rate homogeneity when applied to the C. cf. podiciferus complex alone. Description of evolutionary models can be found in Posada and Crandall (1998). BIC model selection Likelihood ratio testing Locus n Model -InL BIC x 2 df p-value Total data set (all taxa) 12S 380 SYM + G 1880.3461 3796.3333 91.6466 45 0.0000498" 16S 357 GTR + I 1456.9196 2966.7388 44.7136 44 0.44168 COITOTAL 507 HKY +1 + G 2963.5994 5964.5698 65.97378 36 0.0016833" (-Ulposjtionl 169 1(80 + G 580.5992 1171.4581 *-*-"position2 169 TrN 372.6541 770.9576 ^-Ulposition3 169 GTR + G 1712.8069 3471.7830 c-myc 414 1(80 +1 1123.6691 2259.3899 44.45174 34 0.10825 Total4.gene 1658 SYM + 1 + G 7757.1875 15566.2686 Craugastor cf. podiciferus + Craugastor sp. A (only focal taxa) 12S 380 TrNef + G 1145.1263 2308.0732 52.266 38 0.061564 16S 357 HKY + G 887.4183 1804.2253 29.56436 37 0.80867 COITOTAL 507 HKY + G 1935.4519 3902.0464 41.2516 31 0.10317 c-myc 414 JC 868.0661 1736.1322 25.61098 29 0.64619 the nuclear locus, it is feasible that the relationship of nuclear al- leles may be overwhelmed by phylogenetic signal from the mtDNA data. To examine this potential issue we constructed a 95% plausi- ble parsimony network from c-myc haplotypes for focal taxa in- cluded in the C. podiciferus complex using the program TCS 1.21 (Clement et al., 2000). Additionally, to better assess the levels of c-myc diversity we used DnaSP 4.9 (Rozas et al., 2003) to calculate per site nucleotide diversity (n). 2.5, Estimating divergence times Prior to estimating divergence times, we tested each locus for a molecular clock (homogeneity of branch lengths) in (1) a global context using all samples and (2) a local context using a subset including only C. podiciferus complex frogs (focal taxa). Testing was achieved via the use of likelihood ratio tests (Felsenstein, 1981) assuming those evolutionary models selected under BIC in Modeltest 3.7. We chose to estimate divergence dates generated from (1) a molecular clock and (2) previously published dates for Craugastor (Crawford, 2003b; Crawford and Smith, 2005; Heinicke et al., 2007) in an attempt to generate confidence intervals around esti- mated divergence times. To evoke a broad sense molecular clock we applied a sequence divergence rate of 0.75% per million years (my) per lineage since the mean rate across vertebrate mtDNA is generally estimated to be between roughly 0.50-1.0% per my per lineage (Klicka and Zink, 1997; Macey et al., 2001). To estimate divergence times using previously suggested dates, we calibrated our phytogeny using two published divergence times for the Time to Most Recent Common Ancestor (TMRCA) between the C. podiciferus complex and C. cf. longirostris. Heinicke et al. (2007) used a combination of fossil dates and insular emergence in the West Indies to obtain a TMRCA of C. podiciferus and C. cf. longirostris (C. fitzingeri group) at 27.63 to 13.85 million years ago (Ma). Craw- ford and Smith (2005) used previously calibrated substitution rates and a proto-Antilles biogeographic model for Central America to obtain a TMCRA of 58-38 Ma. For each of these estimates, we ran a relaxed clock analysis calibrated with the respective TMRCA of C. podiciferus and C. cf. longirostris. Since no published estimate for the TMRCA between the C. podiciferus complex and C. cf. longi- rostris exceeds 60 Ma, we limited the root height of the tree at this point for all analyses. All divergence estimates were generated using the computer program BEAST 1.4.7 (Drummond and Rambaut, 2007). This pro- gram uses a Bayesian MCMC algorithm and allows users to esti- mate rates and dates using both strict and relaxed molecular clock approaches. In conducting these divergence estimates we used identical parameter settings to those from the MrBayes 3.1.2 analysis using the BIC model selected for the entire align- ment. Because the relatedness of many taxa in this study is above the species level, a constant lineage birth rate Yule tree prior was used along with constant rate models (in strict molecular clock analyses) and uncorrelated lognormal models (in relaxed molecu- lar clock analyses). Following the completion of parallel runs in BEAST 1.4.7 the consensus topologies were examined to confirm congruence with the previously generated Bayesian phytogeny. Convergence of these runs was checked using TRACER 1.4 (Ram- baut and Drummond, 2004) and all parameter sampling exceeded an effective sample size of 200. Given the suboptimal condition of a single calibration point and a desire to be conservative in our divergence estimation, we used a combination of relaxed and strict rate methods when enforcing the Crawford and Smith (2005) and Heinicke et al. (2007) constraint schemes. After applying a con- straint scheme, we sampled divergence rates (per my per lineage) across the Bayesian phylogeny using relaxed clock analysis (Drum- mond et al., 2006) in BEAST 1.4.7 and then subsequently in a sec- ond BEAST 1.4.7 analysis (with no constraints) applied the sampled mean rate as a molecular clock to segments of our topology that failed to reject rate homogeneity. 3. Results 3.7. Sequence analyses and model selection Homology assessment was not obvious for small portions of the aligned ribosomal DNA sequences (12S and 16S) and the intron re- gion of the scnDNA (c-myc) so these variable regions, which ranged in size from 19 to 114 bases, were excluded from all phylogenetic analysis. The majority of c-myc sequences across all taxa were found to be homozygous. Those identified as heterozygous did not share alleles with any other samples included in this study. Heterozygosity was limited to 1 -2 bases per heterozygous individ- ual that were coded as degenerate sites prior to analysis. In total, the final alignment contained 380 bp of the 12S region, 357 bp of 16S, 507 bp of COI, and 414 bp of c-myc (intron 2) for a total of 1658 sites. This alignment is available from TreeBASE at www. treebase.org (Study No.: S2444; Matrix No.: M4647). No locus showed any departure from equal nucleotide freq uencies among taxa as evidenced by the following j2 statistics: 12S (/??? =36.73, p = 1.0), 16S (x?1351 = 15.14, p = 1.0), COI X^-36.73. J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 625 (./([111] = 44.35, p = 1.0), and c-nryc (xf105] = 6.10, p = 1.0). The ILD test found that the separate data partitions did not produce signifi- cantly different topologies (p = 0.17). Therefore, the data were ana- lyzed phylogenetically as a single contiguous alignment. Within this concatenated data set 1111 sites were constant and of the var- iable sites 140 were variable but parsimony uninformative and 407 parsimony informative. Evolutionary models selected by B1C and used in the partitioned and non-partitioned Bayesian MCMC anal- yses are listed in Table 3. Partitioned Bayesian analysis of the total data set was conducted using six partitions (12S, 16S, C01poSitioni. COIposition2, COIposition3, and c-nryc, respectively; Table 3), each with independent parameters, which is relatively complex when com- pared to the employment of the SYM + I + G model (Total4_gene; Ta- ble 3) across all sites. We present the results of the partitioned analysis below since it has been suggested that phylogenetic accu- racy is more vulnerable to models which are under-parameterized rather than those which are over-parameterized (Huelsenbeck and Rannala, 2004). Based on AWTY visualization, topological conver- gence of MrBayes runs occurred at ca. 7,000,000 generations, so the first 7000 trees from each run were discarded as burn-in, leav- ing a combined 6000 samples to estimate marginal posterior prob- abilities of topologies, branch lengths and parameter values. 3.2. Phylogenetic reconstructions Phytogenies generated by NJ, MP, and partitioned and non-par- titioned Bayesian MCMC analyses for the combined data are con- cordant in their support of a series of monophyletic groups within the C. podiciferus complex. Disagreement between topolo- gies was confined to terminal nodes with little statistical support in all analyses. The distinct clades (haplogroups) within the com- plex are best described by the geographic origins of their constitu- ent taxa (Fig. 1). 'Clade A' includes frogs from the southern Tilaran range and the northern Central range (localities 1-3; Fig. 1). 'Clade B' also in- cludes frogs from the southern Tilaran range and northern Central range (localities 1 and 4, respectively; Fig 1.). 'Clade C includes frogs from the Central range and the extreme northern portions of the Talamancan range (localities 5, 8, and 9; Fig. 1). 'Clade D' in- cludes frogs from the Central range (localities 5-7; Fig. 1). 'Clade E' contains frogs from the Pacific slope of the Talamancan range (locality 10; Fig. 1). 'Clade F' includes frogs from a low disjunct mountain range on the Pacific slope of the Talamancas known as the Fila Costena (locality 11; Fig. 1). 'Clade G' is comprised of indi- viduals from montane western Panama (locality 12; Fig. 1). Clades A-F form a well-supported monophyletic group endemic to Costa Rica (Fig. 1 and 2). We define this clade as C. cf. podiciferus pending further systematic revision. Within the C. cf. podiciferus clade there is limited but significant branch support for a northern group con- taining Clades A-D and a southern group containing clades E and F which we label I and II, respectively (Fig. 2). 'Clade G' from western Panama was recovered as sister to the lowland samples (C. bran- sfordii and others) on our optimal trees, although with relatively poor statistical support (Fig. 2). Thus, rather than include Clade G in the C. podiciferus complex, we refer to the lineage as Craugastor sp. A. The lowland taxa used in this study (C bransfordii and others) form a clade that is phylogenetically consistent with previous find- ings for these species (Crawford and Smith, 2005; Hedges et al., 2008). For the 95% plausible c-nryc parsimony network of the C. cf. podiciferus clade (Fig. 3), nuclear sequences were trimmed to 331 bp so that any sequence length heterogeneity was confined to a small number of internal indels. The network contained a total of 14 unique haplotypes excluding degenerate sites. The network supported our Bayesian phytogeny in recovering the northern and southern groups (I and II, respectively). No clades identified *4 \ Mj _ r11 ? ?r 1-9 22 21 20 17 18 26 25 13 I- 14 16 12 19 ssr 23 24 M Southern Costa Rica Crsugsslor cf. podiciferus 13 Northem/C ential Costa Rica Craugastor c? padiciFcnis - GuugasJOT IJF. Irajgxroatn'j (47) ?C. !rf?s?r.c(45) C. trmdWii (44) I C. iflHlerwwdi (42) 1-C. UJKfc7WK&(41) Fig. 2. Bayesian phytogeny from mixed-model multilocus dataset depicting rela- tionships within the Craugastor podiciferus complex. Numbers found at the end of terminal branches correspond with taxon and institutional voucher numbers from Table 1. Posterior probabilities resulting from Bayesian Markov chain Monte Carlo analysis and non-parametric bootstrap values generated from 2000 replicates appear above branches. Partitioned Bremer support values (decay indices) appear below branches. An asterisk (*) represents values of 100. See text for description of clade and group designations (A-G and I and II, respectively). Fig. 3. Parsimony network featuring 14 nuclear c-myc haplotypes recovered from the Costa Rican focal taxa included in this study. Circles represent unique haplotypes. Colored circle shading and labeling (A-F) corresponds to the clades in Fig 2. Description of group designation (I and II) can be found in text. by mtDNA (A-F) shared c-myc haplotypes; thus, Clades A-F are monophyletic at both mtDNA and scnDNA markers. The southern group (II) showed a greater ft value among nuclear haplotypes than 626 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 did the northern group (I) (2N = 6, ft = 0.00694, respectively). ft = 0.00784 vs. 2N=18, 3.3. Estimation of evolutionary rates and divergence A summary (by gene region) of the x2 statistics resulting from the LRT tests is included in Table 3. In the analysis including all samples, two loci rejected the constant rate model of a molecular clock (p < 0.002) and two failed to reject it (p > 0.05). In the local clock analyses of just C. cf. podiciferus plus C. sp. A (Clade G) all re- gions failed to reject a molecular clock suggesting that the majority of rate heterogeneity is confined to the lowland taxa, such as C. ste- jnegerianus (Fig. 2). Estimated mean rate assuming the temporal calibration based on Heinicke et al. (2007) was 0.57% sequence divergence per my per lineage (95% highest posterior density [HPD] =0.27-0.92;) which contrasts with the rate of 0.22% (HPD = 0.14-0.30) obtained when assuming the Crawford and Smith (2005) calibration. Diver- gence estimates from the three analyses generated disparate diver- gence times for this group of taxa. Relaxed clock dates (collected during rate sampling) had older ages for internal nodes relative to those dates recovered when using the sampled mean divergence rate as a molecular clock. The inverse situation occurred for basal nodes where relaxed clock dates had younger ages relative to the molecular clock analyses (Table 4). 4. Disscussion 4.1. Phylogenetic relationships Cryptic diversity in terraranan lineages has been observed on multiple occasions (e.g., Miyamato, 1983; Crawford 2003a; Craw- ford and Smith, 2005; Elmer et al., 2007; Crawford et al., 2007; Wang et al., 2008; Padial and De la Riva, 2009). However, the C. podiciferus complex is atypical when compared to previous exam- ples in that many of the divergent lineages described herein are syntopic with one another (Fig. 1). The levels of sequence diver- gence within the complex (Table 5) are notable given the small geographic range of ca. 8000 km2 that it is known to occupy (IUCN, 2006). Patterns that are evident in both the mitochondrial and nu- clear data include the restriction of the C. cf. podiciferus clade to Costa Rica (CR) and a northern and southern division (groups I and II, respectively; Fig. 2) within CR. As reported previously (Crawford and Smith, 2005; Chen, 2005), C. podiciferus complex frogs from western Panama (Clade G, aka Craugastor sp. A) fall well outside the Costa Rican taxa. Our Bayesian analysis and Crawford and Smith (2005) recovered C. podiriferus-like animals as paraphy- letic with respect to the lowland taxa, although the statistical sup- port for these relationships was weak in both studies. Although we are unable to make firm conclusions regarding the phylogenetic position of the Panamanian portion of the C. podiciferus complex at this time, clearly Craugastor sp. A is a distinct evolutionary en- tity. Craugastor sp. A is directly referable to "C. sp. B" of Crawford and Smith (2005) as their study and ours both included the sample, FMNH 257689, from western Panama. The distribution of nuclear haplotypes (Fig. 3) within the C. cf. podiciferus clade appears to mirror the deeper phylogenetic rela- tionships recovered in the multi-locus Bayesian analysis. Although our sampling provides no evidence of shared nuclear haplotypes among clades identified from the predominately mtDNA concate- nated dataset, Clades B and 0 are not reciprocally monophyletic at the c-myc marker (Fig. 3). Lack of nuclear monophyly in these mtDNA clades could be due to introgression or incomplete lineage sorting. Range overlap among mtDNA lineages suggests introgres- sion may be possible, while the large effective population sizes and incomplete lineage sorting observed at the c-myc gene in other members of the C. podiciferus species group (Crawford 2003a) sug- gest that lack of monophyly could also reflect segregating ancestral polymorphisms. The greater ft value for nuclear haplotypes in the Table 4 Time to most recent common ancestor (TMRCA) in millions of years (my) obtained using three separate dating/rate criteria under molecular clocks. Also presented are dates corresponding to estimated rates of sequence divergence acquired in the analogous relaxed clock analyses for constraint schemes (1) Heinicke et al. (2007) and (2) Crawford and Smith (2005). TMRCA values below the black line belong to focal taxa in this study. Approximate rates are presented per million years per lineage. Molecular clock rates per million years per lineage (my/1) Relaxed clock rates per my/1 0.75% 0.57% 022% (0.27-0.92%) constraint scheme 1 (0.14-0.30%) constraint scheme 2 Node (TMRCA) Mean (95% HPD) Mean (95% HPD) Mean (95% HPD) Mean (95% HPD) Mean (95% HPD) C cf. podiciferus-C. cf. longirostris 19.28 (16.82,21.86) 24.72 (21.38,27.84) 65.37 (56.72, 73.93) 18.79 (10.39, 27.98) 46.78 (36.86,56.41) C bransfordii-C. cf. podiciferus 12.48 (10.82, 14.28) 16.02 (13.81,18.18) 42.29 (36.64, 48.35) 15.21 (7.04, 23.64) 38.44 (24.98,51.48) C. cf. podiciferus-Clade G 7.94 (6.64. 9.08) 10.16 (8.72,11.81) 26.85 (22.80.31.01) 15.21 (7.04, 23.64) 38.44 (24.98,51.48) C cf. podiciferus (I and II) 5.54 (4.70, 6.40) 7.08 (6.04.8.18) 18.70 (15.95,21.65) 11.45 (4.85. 19.08) 29.29 (16.32,42.11) Group I (crown age) 4.88 (4.18, 5.76) 6.25 (5.34,7.21) 16.51 (14.11,19.30) 9.00 (3.61, 15.37) 23.40 (12.69, 35.63) Clade A (crown age) 0.44 (0.24, 0.66) 0.55 (0.29. 0.83) 1.48 (0.81.2.24) 2.05 (0.28, 4.55) 5.10 (0.80. 10.83) Clade B (crown age) 1.10 (0.60, 1.60) 1.41 (0.82. 2.08) 3.71 (2.11,5.44) 3.54 (0.80, 6.85) 8.18 (2.50, 15.23) Clade C (crown age) 0.90 (0.56, 1.24) 1.14 (0.72. 1.59) 3.01 (1.90,4.13) 3.02 (0.66, 5.94) 7.52 (2.30, 14.01) Clade D (crown age) 0.70 (0.40, 1.02) 0.90 (0.53. 1.29) 2.40 (1.35,3.43) 2.38 (0.54, 5.06) 6.21 (1.02, 13.60) Clade E (crown age) 0.22 (0.04, 0.48) 0.28 (0.03, 0.60) 0.76 (0.08, 1.61) 1.00 (0.02, 3.02) 2.47 (0.05. 7.35) Clade F (crown age) 0.60 (0.40, 0.84) 0.76 (0.48. 1.05) 2.01 (1.29,2.84) 2.63 (0.55, 5.29) 6.40 (1.62, 12.12) Clade G (crown age) 0.94 (0.60, 1.32) 1.21 (0.78. 1.68) 3.23 (1.98,4.51) 3.93 (0.86,8.15) 9.18 (2.58, 17.69) Table 5 Genetic variability partitioned by locus for (1) the maximum amount of sequence divergence within the C. podiciferus complex (focal taxon) and (2) the maximum amount of sequence divergence among all taxa included in this study. Distances are based on uncorrected "p" values. Also presented is the number of focal taxon haplotypes recovered for each locus. Locus # of bases # of focal taxa # of haplotypes Ma 12S 380 40 30 11 16S 357 39 24 7 CO! 507 33 26 17 c-myc 414 31 22 5 x.% divergence among focal taxa (%) Max.% divergence with outgroup (%) 20 16 26 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 627 southern group (II) may be explained by the age of the Cordillera de Talamanca relative to the northern/central mountain ranges of Costa Rica (ca. 14 vs. 3 my, respectively [Denyer et al., 2000; Mar- shall et al., 2003; MacMillan et al., 2004]) and indicate the presence of ancestral C. podiciferus complex frogs in this Cordillera prior to the younger ranges. 4.2. Biogeography of Craugastor podiciferus Considering the methodology used to obtain divergence esti- mates and the rejection of the molecular clock by two genes in the global context (Table 3), we primarily restrict our biogeo- graphic commentary to the C. podiciferus complex. We use the clock-like rates shared by these focal lineages to identify a range of sequence divergence rates (and hence their respective time- frames) that seem most likely given the geologic and environmen- tal history of montane Costa Rica and western Panama. Geologic times and period boundaries are based on Gradstein et al. (2005). The topology recovered for our focal taxa (Box 1; Fig. 4) contains six unique clades collectively distributed across three mountain ranges. Among these ranges, the oldest radiometric dated deposits discovered thus far originate from the Cordillera de Talamanca and are between 13 and 14 my old (MacMillan et al., 2004). Although Central America may have been a continuous peninsula 20 Ma (Kirby et al., 2008), we assume a boundary condition of 14 Ma for the presence of mountain habitat. We refrain from discussing TMRCA estimates associated with the 0.22% per my per lineage rate in detail since many of the internal node dates predate this boundary condition; however, even though this rate would indi- cate isolating mechanisms before radiation into the Cordillera de Talamanca, future consideration is warranted as an alternative explanation to the model we present below. The earliest Cordillera de Talamanca radiation by any frog in this study should coincide with the TMRCA for the C cf. podiciferus and Craugastor sp. A clades. Based on our divergence results, diver- gence rates between ca. 0.57% and 0.75% per my per lineage pro- duce a TMRCA estimate between 11.81 and 6.64 Ma for this node (Table 4) which fits our boundary condition. The other Cordilleras that the C. podiciferus complex is known to inhabit (Cordillera de Central and Cordillera de Tilaran) are volcanically active and sub- stantially younger, having been formed during the late Tertiary and Quaternary (Denyer et al., 2000; Marshall et al., 2003). The pri- mary restriction of group I C. cf. podiciferus clade taxa (Clades A-D) to these northern/central Cordilleras and the lower ft values in this group (I), suggest that these mountains have played a role in the origin of this group. Divergence rates between ca. 0.57 and 0.75% place the origin of this group (TMRCA, Group I; Table 4) between 7.21 and 4.18 Ma (late Miocene through middle Pliocene). Despite predating the hypothesized origins of the northern/central Cordill- eras, these dates overlap the presence of the now extinct Cordillera de Aguacate in northwestern Costa Rica (ca. 5 Ma; Marshall et al., 2003). For shallower nodes in our phylogeny, there are several issues that complicate our ability to elucidate natural barriers that may have affected dispersal or led to vicariance in the C. podiciferus complex. In particular, a recurrent and enigmatic find is the syn- topic occurrence of divergent haplogroups at the same locality (localities 1 and 5 in Fig. 1.). Based on our divergence estimates, we explain the origin of diversity with the description of a local- ized version of the temperature depression model presented by Savage (2002) that is congruent with the observed genetic Box 1 Topology Box 3 ca.7.0-1.0MYA mmmmmm Suitable habitat Origin by isolation (warming) Box 4 ca. 1.0- 0.20 MY A Quercus 1000 m drop 0MYA I.S 3.5 5.3 7 Box 2 ca. climate patterns I, I Suitable habitat Movement and sympatry (cooling) Box 5 Cordillera dc Cordillera de Tilaran Centra! Cordillera de Talamanca present I Suitable habitat Fig. 4. Model for evolutionary origin and geographic spread of Craugastor cf. podiciferus clade. Inset boxes (1-5) are described as follows: (1) Cladogram depicting the relationships between C. cf. podiciferus clade haplogroups. (2) Generalized climate patterns over the last 7 my using change in temperature against time. Note shaded area which corresponds to a 1000 m drop in oak species (Quercus spp.) that currently share habitat with the C. podiciferus complex. This indicates periods when lowland dispersal corridors were likely available for highland taxa. The dotted line in this graph represents the current temperature. (3) Diagrammatic representation of the origin of each of these haplogroups by isolation during warming periods throughout the late Miocene and early Pleistocene. (4) Diagrammatic representation of sympatric conditions that most likely occurred among haplogroups multiple times during Pleistocene cooling events. (5) Current distribution of haplogroups in four disjunct fragments (f-1 through f-4) of Talamancan montane forest. 628 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 variation and geographic distribution of the C. cf. podiciferus haplo- type groups. We employ this model under the hypothesis that opportunities for dispersal and the occurrence of vicariance in the C. podiciferus complex have been controlled by habitat continu- ity; thus, the movement of these frogs has been limited by climatic fluctuations which generated periods of habitat discontinuities be- tween the three mountain ranges in question. In order for this hypothesis to be realistic (given the taxa in this study), three pri- mary assumptions are required: (1) taxa unique to each 'island- like' fragment of TMF (Box 5; Fig. 4) are presently restricted from movement between fragments, (2) anthropogenic interference (e.g., translocation/poor data collection) has not occurred in our sampling of these taxa (Lynch and Duellman, 1997), and (3) the ecological niche of these frogs has been largely conserved through time. Prior to approximately 7 Ma (Zachos et al., 2001), global tem- peratures were consistently above the current temperature levels indicating that ancestral C. podiciferus complex frogs should have been locally isolated during this time. From approximately 7- 2 Ma, global temperatures reached similar levels to present and during multiple gradations dropped below this level (Lisiecki and Raymo, 2005) which would have briefly lowered TMF habitat allowing for expansion and mixing of present day high elevation fauna and flora via the lowlands (Fig 4, Box 4). Following these habitat depressions subsequent interglacial periods would have forced these expanded communities upwards and imposed isola- tion once again. Using the ca. 0.57-0.75% rates of sequence diver- gence, the timing of these cycles roughly matches the origin of the C. cf. podiciferus clade groups (I and II; Table 4) between 8.18 and 4.70 Ma. More recently (1 Ma), a transition to more rapid gla- cial cycles of 0.01 my with climate fluctuations of 4 ?C and lower should have provided the C. cf. podiciferus clade groups with suffi- cient time for dispersal and mixing (between fragments) during these cycles (Boxes 3 and 4; Fig 4.). The TMRCA for each haplo- group that would have originated during these periods (Clades A-F) matches this shift in cycle period when using rates of ca. 0.57-0.75% per my per lineage in that these rates produce TMRCA dates between 2.08 and 0.04 Ma. This type of dispersal also re- solves the occurrence of the syntopic yet divergent clades (A and B, C and D, respectively; Fig 1) and Group I individuals in northern sections of the Cordillera de Talamanca (Locality 9; Fig. 1) all of which were presumably forced upward and restricted to their current location at the end of the last glacial cycle (Box 5; Fig. 4). Given our hypothesized topology (Box 1; Fig. 4) and the distinction between Clades A-D and Clades E and F (groups I and II, respec- tively), the putative admixture of haplogroups (Box 4; Fig. 4) may have not been panmictic across lowlands but rather locally confined within groups (I and II) and also species (C podiciferus complex and Craugastor sp. A). If supported by future sampling, this further localized admixture would suggest biogeographic breaks between Localities 9 and 10 and Localities 11 and 12 (Fig. 1). While this model is an oversimplification of the mosaic- like structure of temperature and habitat variables that likely drove these events, it does offer a generalized explanation for the observed distributional patterns of C. cf. podiciferus clade haplo- groups that is consistent with hypothesized geologic events. Addi- tionally, there is preliminary evidence that suggests similar elevational shifts in montane amphibian distributions are pres- ently occurring in response to the changing climate (Raxworthy et al., 2008). 4.3. Conclusion and future directions Although members of the C. podiciferus complex are relatively abundant and familiar to most naturalists in Costa Rica, they have been poorly studied given the tendency for their phenotypic poly- morphism to confound gestalt-based field identification. This diffi- culty has plagued the complex since its description in the late 19th century when Cope (1875) noted the high levels of phenotypic var- iability in C. podiciferus: "The colors in this species vary remarkably, more than I have observed to be the case in any other frog". In revis- iting our study objectives we report that (1) the C. podiciferus com- plex possesses relatively extensive genetic diversity across its known range, especially on the Pacific versant of the Cordillera de Talamanca; (2) with two notable exceptions, this complex has a phy- logenetic history that corresponds with geography; and (3) the two instances of sympatric yet highly divergent haplotypes can be ex- plained via a Pliocene-Pleistocene temperature depression model. The evidence presented here supports the suggestion of previ- ous authors that the current concept of C. podiciferus includes mul- tiple taxa (Savage, 2002; Chen, 2005; Crawford and Smith, 2005). Future molecular sampling, coupled with detailed morphological analyses are necessary to delineate species boundaries within the complex. Currently, an extensive morphological analysis of this group is in progress and preliminary comparisons to this molecular phylogeny appear generally congruent (J.M. Savage, pers. comm.). We recommend that genetic sampling from the Cordillera de Talamanca (particularly from the type locality of Cerro Utyum) be conducted prior to the construction of a revised species level taxonomy for the group. Additionally, the presence and status of C. pod/ri/erus-like frogs in the Tabasara range of Panama requires further examination. The level of genetic divergence in sympatry documented in this examination of the C. podiciferus complex provides evidence that climatic fluctuation during the Pleistocene in lower Central Amer- ica may have contributed to the high levels of lineage and species richness observed in the montane biota of this region, however; more homogeneous sampling of the complex is necessary to test this hypothesis. The rate heterogeneity documented between montane (C. podiciferus complex) and lowland (C. bransfordii and others) frog species in our study (Fig. 2; Table 3) may be explained by ecological differences related to elevation and should be explored further with comparison to similarly stratified biota in Isthmian Central America. While the levels of diversity in the C. podiciferus complex are notable, in order to identify general phy- logeographic patterns in the lower Central American Cordilleras, there is a need for analogous studies in additional taxonomic groups (e.g., Garcia-Paris et al., 2000). The presence of at least 6 distinct clades of C. podiciferus complex frogs in Costa Rica empha- sizes the need for future conservation plans to maintain as much of the TMF as possible. This would protect not only the remarkable known diversity, but also the potential cryptic diversity that may be uncovered as studies similar to the present one are conducted on additional montane organisms. Acknowledgments CR field collecting conducted by J.W.S. was under MINAE permit #0098520004 (License #38312). Collecting by A.J.C. in CR was made under permiso de investigation N? 024-2002-OFAU, among others, and supported by an NSF International Postdoctoral Fellow- ship. J.W.S. sincerely thanks S. Mohammad! and K. Nishida for help with collecting permits and J. Lewis, D. Blackford, J. Bajwa, and S. Itoh for field assistance. A.J.C. thanks F. Bolanos for support and guidance in CR, and K.R. Lips for help in western Panama. Collect- ing permits in Panama were kindly granted by ANAM (permit number SE/A-66-03) and obtained with the help of O. Arosemena. Panama fieldwork was supported by a Smithsonian Postdoctoral Fellowship in Molecular Evolution to A.J.C. For access to tissue samples and specimens, we are grateful to the following persons (and their institutions): R.W. McDiarmid, A.H. Wynn, and R.V. Wilson (USNM), E.N. Smith and C.J. Franklin (UTA), and A. Resetar (FMNH). DNA sequencing was conducted in the GMU J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 629 biocomplexity laboratory of P.M. Gillevet under the guidance of M. Sikaroodi. We thank the following individuals for lab support: K. Bryant, T. Henry, T. Tupper, S. Johnson, and M. Jarcho. We thank C.H. Ernst and W.R. Heyer for reviewing earlier versions of the manuscript and the D.C. Cannatella lab group (UT) for holding a discussion group regarding this project where many beneficial comments and criticisms were received. We are indebted to J.M. Meik, G.B. Pauly, and 2 anonymous reviewers for providing com- ments that greatly increased the quality and clarity of the manu- script. We thank J.M. Savage for discussions of his data and observations. Portions of this study were completed in partial ful- fillment of requirements for an M.S. degree to J.W.S. References Arellano, E., Rogers. D.S., Cervantes, FA, 2003. Genie differentiation and phylogenetic relationships among tropical harvest mice (Reithrodontomys: subgenus Aprorodon). J. Mammal. 84 (1), 129-143. Baker, R.H., Yu, X.B., DeSalle, R., 1998. Assessing the relative contribution of molecular and morphological characters in simultaneous analysis trees. Mol. Phylogenet. Evol. 9. 427-436. Beebee, T.J.C., 2005. Conservation genetics of amphibians. Heredity 95, 423-427. Bossuyt, F.. Milinkovitch. M.C., 2000. Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proc. Natl. Acad. Sci. USA 97, 6585-6590. Cadena, CD., Klicka, J., Ricklefs, R.E., 2007. Evolutionary differentiation in a tropical montane region: molecular phylogenetics and phylogeography of Buarremon brush finches (Aves. Emberizidae). Mol. Phylogenet. Evol. 44. 993-1016. Campbell, J.A., 1999. Distribution patterns of amphibians in Middle America. In: Duellman, W.E. (Ed.). Patterns of Distributions of Amphibians: A Global Perspective. JHU Press, pp. 111-210. Castoe, T.A., Sasa, M.A., Parkinson, C.L, 2005. Modeling nucleotide evolution at the mesoscale: the phylogeny of pitvipers of the Porthidium group (Viperidae: Crotalinae). Mol. Phylogenet. Evol. 37, 881-898. Chen, S.H., 2005. Chromosomal variation in the rhodopsis group of the southern Central American Eleutherodactyline frogs (Leptodactylidae: Eleutherodactylus). In: Donnelly, M.A. (Ed.), Ecology and Evolution in the Tropics: A Herpetological Perspective. The University of Chicago Press, pp. 102-144. Clement, M., Posada, D., Crandall, K? 2000. TCS: a computer program to estimate gene genealogies. Mol. Ecol. 9 (10), 1657-1660. Colinvaux, P.A., 1991. A commentary on: palaeoecological background: neotropics. Climatic Change 19, 49-51. Colinvaux. P.A., Liu. K-B., de Oliveira, P., Bush. M.B.. Miller, M.C., Steinitz-Kannan, M., 1996. Temperature depression in the lowland tropics in glacial times. Climatic Change 32, 19-33. Cope, E.D.. 1875. On the Batrachia and Reptilia of Costa Rica. J. Acad. Nat. Sci. Phila. Ser. 2(8), 107. Crawford, A.J., 2003a. Huge populations and old species of Costa Rican and Panamanian dirt frogs inferred from mitochondrial and nuclear gene sequences. Mol. Ecol. 12. 2525-2540. Crawford, A.J.. 2003b. Relative rates of nucleotide substitution in frogs. J. Mol. Evol. 57,36-641. Crawford, A.J., Smith, E.N., 2005. Cenozoic biogeography and evolution in direct- developing frogs of Central America (Leptodactylidae: Eleutherodactylus) as inferred from a phylogenetic analysis of nuclear and mitochondrial genes. Mol. Phylogenet. Evol. 35. 536-555. Crawford, A.J., Bermingham, E.. Polania, C, 2007. The role of tropical dry forest as a long-term barrier to dispersal: a comparative phylogeographic analysis of dry forest tolerant and intolerant frogs. Mol. Ecol. 16, 4789-4807. Denyer, P., Alvarado, G.E.. Aguilar, T.. 2000. Historia geologica. In: Denyer, P., Ussmaul, S. (Eds.), Geologia de Costa Rica. Editorial Tecnologica de Costa Rica, Cartago, Costa Rica, pp. 155-167. Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214. Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogenetics and dating with confidence. PLoS Biol. 4, 699-710. Don. R.H., Cox, P.T., Wainwright, B.J.. Baker. K., Mattick, J.S., 1991. Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19,4008. Elmer, K.R., Davila, J.A., Lougheed, S.C., 2007. Cryptic diversity and deep divergence in an upper Amazonian leaflitter frog, Eleutherodactylus ockendeni. BMC Evol. Biol. 7. 247. Farris, J.S., Kallersjo, M., Kluge. A.G., Bult, C. 1994. Testing significance of incongruence. Cladistics 10, 315-319. Felsenstein, J.. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. J. Mol. Evol. 17, 368-376. Garcia-Paris, M., Good, D.A., Parra-Olea, G., Wake, D.B., 2000. Biodiversity of Costa Rican salamanders: implications of high levels of genetic differentiation and phylogeographic structure for species formation. Proc. Natl. Acad. Sci. USA 97, 1640-1647. Ghalambor, C.K., Huey, R.B., Martin, P.R., Tewksbury, J.J., Wang, G., 2006. Are mountain passes higher in the tropics? Janzen's hypothesis revisited. Int. Comp. Biol. 46(1), 5-17. Gradstein, F.M., Ogg, J.G.. Smith, A.G. (Eds.), 2005. A Geologic Timescale 2004. Cambridge University Press. Hafner. M.S., 1991. Evolutionary genetics and zoogeography of Middle American pocket gophers, genus Ort/iogeomys. J. Mammal. 72 (1), 1-10. Hare, M.P.. Palumbi, S.R., 1999. The accuracy of heterozygous base calling from diploid sequence and resolution of haplotypes using allele-specific sequencing. Mol. Ecol. 8. 1750-1752. Hedges, S.B, Duellman, W.E., Heinicke, M.P., 2008. New World direct-developing frogs (Anura: Terrarana): molecular phylogeny, classification, biogeography, and conservation. Zootaxa 1737.182 pp. Hedges, S.B., 1992. The number of replications needed for accurate estimation of the bootstrap P value in phylogenetic studies. Mol. Biol. Evol. 9. 366- 369. Heinicke, M.P., Duellman, W.E., Hedges, S.B., 2007. Major Carribean and Central American frog faunas originated by ancient oceanic dispersal. Proc. Natl. Acad. Sci. USA 104. 10092-10097. Huelsenbeck. J.P., Rannala, B., 2004. Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Syst. Biol. 53, 904-913. 1UCN, Conservation International, and NatureServe. 2006. Global Amphibian Assessment, www.globalamphibians.org, version 1.1. IUCN, Conservation International, and NatureServe. Janzen. D.H., 1967. Why mountain passes are higher in the tropics. Am. Nat. 101, 233-249. Kessing, B.D.. Croom, H., Martin, A.P., Mclntosh, C, McMillam. W.O., Palumbi, S.R.. 1989. A Simple Fool's Guide to PCR. Department of Zoology, University of Hawaii. Honolulu. Kessler, M., Kluge, J., 2008. Diversity and endemism in tropical montane forests - from patterns to processes. In: Gradstein, S.R., Homeier, J., Gansert, D. (Eds.), The Tropical Mountain Forest: Patterns and Processes in a Biodiversity Hotspot. Gottingen Centre for Biodiversity and Ecology, vol. 2. Biodiversity and Ecology Series, pp. 35-50. Kirby, M.X., Jones, D.S., MacFadden, B.J., 2008. Lower Miocene stratigraphy along the Panama Canal and Its bearing on the Central American peninsula. PLoS ONE 3. e2791. Klicka. J., Zink, R.M., 1997. The importance of recent ice ages in speciation: a failed paradigm. Science 277, 1666-1669. Lips, K.R., 1999. Mass mortality and population declines of anurans at an upland site in western Panama. Cons. Biol. 13 (1), 117-125. Lisiecki, L.E.. Raymo, M.E., 2005. A Pliocene-Pleistocene stack of 57 globally distributed benthic 518 O records. Paleoceanography 20, PA1003. Liu, W., Lanthrop, A.. Fu, J.. Yang. D.. Murphy, R.W., 2000. Phylogeny of East Asian Bufonids inferred from mitochondrial DNA sequences (Anura: Amphibia). Mol. Phylogenet. Evol. 14, 423-435. Lynch, J.D., 2000. The relationships of an ensemble of Guatemalan and Mexican frogs (Eleutherodactylus: Leptodactylidae: Amphibia). Rev. Acad. Colomb Cienc. 24,129-156. Lynch, J.D., Duellman, W.E.. 1997. Frogs of the genus Eleutherodactylus in western Ecuador: systematics, ecology, and biogeography. Univ. Kansas, Nat. Hist. Mus. Spec. Pub. 23, 1-236. Macey, J.R., Strasburg, J.L.. Brisson, J.A., Vredenburg, V.T.. Jennings, M., Larson, A.. 2001. Molecular phylogenetics of western NorthAmerican frogs of the Rana boylii species group. Mol. Phylogenet. Evol. 19.131-143. MacMillan, I., Cans, P.B., Alvarado, G., 2004. Middle Miocene to present plate tectonic history of the southern Central American Volcanic Arc. Tectonophysics 392, 325-348. Marshall, J.S., Idleman, B.D., Gardner, T.W., Fisher, D.M., 2003. Landscape evolution within a retreating volcanic arc. Costa Rica. Central America. Geology 31, 419- 422. Miyamato, M.M., 1983. Biochemical variation in the frog Eleutherodactylus bransfordii: geographic patterns and cryptic species. Syst. Zool. 32. 43-51. Nylander. J.A.A.. Wilgenbusch.J.C. Warren. D.L., Swofford, D.L., 2008. AWTY (are we there yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24, 581-583. Olson, D.M., Dinerstein, E.. Wikramanayake, E.D.. Burgess, N.D., Powell, G.V.N., Underwood, E.C.. D'amico, J.A.. Itoua. L, Strand, H.E.. Morrison, J.C., Loucks, C.J.. Allnutt, T.F., Ricketts, T.H., Kura, Y., Lamoreux, J.F., Wettengel, W.W., Hedao, P., Kassem, K.R., 2001. Terrestrial ecoregions of the world: a new map of life on earth. BioScience 51 (11), 933-938. Padial. J.M., De la Riva, I., 2009. Integrative taxonomy reveals cryptic Amazonian species of Pristimantis (Anura). Zool. J. Linn. Soc. 155, 97-122. Piperno, D.R., Pearsall, D.M., 1998. The Origins of Agriculture in the Lowland Neotropics. Academic Press, San Diego. Pisani, G.R., 1973. A Guide to Preservation Techniques for Amphibians and Reptiles Herpetological Circular 1. Society for the Study of Amphibians and Reptiles, St. Louis, MO, USA. Posada. D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817-818. Posada. D., 2006. ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online. Nucleic Acids Res. 34, 700-703. Pounds, J.A., Crump, MX., 1994. Amphibian declines and climate disturbance: the case of the golden toad and harlequin frog. Conserv. Biol. 8 (1), 72-85. 630 J.W. Stretcher et al./Molecular Phylogenetics and Evolution 53 (2009) 620-630 Puschendorf, R., Bolanos, F., Chaves, G., 2006. The amphibian chytrid fungus along an altitudinal transect before the first reports of declines in Costa Rica. Biol. Conserv. 132 (1). 136-142. Roe. B.A., Ma. D-R, Wilson. R.K., Wong, J.F-H., 1985. The complete nucleotide sequence of the Xenopus laevis mitochondria! DNA genome. J. Biol. Chem. 260, 9759-9774. Rambaut, A., Drummond, A.J., 2004. Tracer vl.3. Available from: . Raxworthy, C.J., Pearson, R.G., Rabibisoa, N., Rakotondrazafy, A.M., Ramanamanjato, J-B., Raselimanana, A.P., Wu, S., Nussbaum, R.A., Stone, D.A., 2008. Extinction vulnerability of tropical montane endemism from warming and upslope displacement: a preliminary appraisal for the highest massif in Madagascar. Glob. Change Biol. 14, 1703-1720. Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572-1574. Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 18, 2496-2497. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., Erlich, H.A., 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425. Savage, J.M., 2002. The Amphibians and Reptiles of Costa Rica: A Herpetofauna between Two Continents, between Two Seas. The University of Chicago Press. Savage, J.M., Emerson, S.B., 1970. Central American frogs allied to Eleutherodactylus bransfordii (Cope): a problem of polymorphism. Copeia, 673-674. Seutin, G., White, B.N., Boag, P.T., 1991. Preservation of avian blood and tissue samples for DNA analyses. Can. J. Zool. 69, 82-90. Sorenson, M.D., 1999. TreeRot, Version 2. Boston University, Boston, MA. Swofford, D.L., 2002. PAUP: Phylogenetic Analysis Using Parsimony (* and other methods). Version 4.0bl0, Sinauer Associates, Inc., Publishers, Sunderland, Massachusetts. Taylor, E.H., 1952. A review of the frogs and toads of Costa Rica. Univ. Kansas Sci. Bull. 35, 577-942. Thompson, J.D., Gibson, T.J., Jeanmougin, F., Plewniak, F., Higgins, D.G., 1997. The ClustalX-Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876-4882. Yang, Z., Rannala, B., 1997. Bayesian phylogenetic inference using DNA sequences: a Markov chain Monte Carlo method. Mol. Biol. Evol. 14, 717-724. Wang, I., Crawford, A.J., Bermingham, E., 2008. Phylogeography of the Pygmy Rain Frog (Pristlmantls ridens) across the lowland tropical forests of Isthmian Central America. Mol. Phylogen. Evol. 47, 992-1004. Weigt, LA., Crawford, A.J., Rand, A.S., Ryan, M.J., 2005. Biogeography of the tungara frog, Physalaemus pustulosus: a molecular perspective. Mol. Ecol. 14, 3857- 3876. Wiens, J.J., Parra-Olea, G., Garcia-Paris, M., Wake, D.B., 2007. Phylogenetic history underlies elevational biodiversity patterns in tropical salamanders. Proc. Roy. Soc. Lond. B 274, 919-928. Wilgenbusch, J.C., Warren, D.C., Swofford, D.L., 2004. AWTY: a system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. Available from: . Zachos, J., Pagani, M., Sloan, L, Thomas, E., Billups, K., 2001. Trends, rhythms, and aberrations in global climate 65 Ma to present. Science 292 (5517), 686-693.