RESEARCH ARTICLE Identification of Candidate Coral Pathogens on White Band Disease-Infected Staghorn Coral Sarah A. Gignoux-Wolfsohn*, Steven V. Vollmer Marine Science Center, Northeastern University, Nahant, Massachusetts, United States of America * gignoux-wolfsohn.s@husky.neu.edu Abstract Bacterial diseases affecting scleractinian corals pose an enormous threat to the health of coral reefs, yet we still have a limited understanding of the bacteria associated with coral diseases. White band disease is a bacterial disease that affects the two Caribbean acro- porid corals, the staghorn coral Acropora cervicornis and the elkhorn coral A. palmate. Spe- cies of Vibrio and Rickettsia have both been identified as putative WBD pathogens. Here we used Illumina 16S rRNA gene sequencing to profile the bacterial communities associated with healthy and diseased A. cervicornis collected from four field sites during two different years. We also exposed corals in tanks to diseased and healthy (control) homogenates to reduce some of the natural variation of field-collected coral bacterial communities. Using a combination of multivariate analyses, we identified community-level changes between dis- eased and healthy corals in both the field-collected and tank-exposed datasets. We then identified changes in the abundances of individual operational taxonomic units (OTUs) between diseased and healthy corals. By comparing the diseased and healthy-associated bacteria in field-collected and tank-exposed corals, we were able to identify 16 healthy- associated OTUs and 106 consistently disease-associated OTUs, which are good candi- dates for putative WBD pathogens. A large percentage of these disease-associated OTUs belonged to the order Flavobacteriales. In addition, two of the putative pathogens identified here belong to orders previously suggested as WBD pathogens: Vibronales and Rickettsiales. Introduction Over the past few decades, coral reefs have experienced an unprecedented rise in the prevalence and impacts of coral disease epizootics [1, 2] with especially severe impacts on Caribbean coral reefs [3]. In spite of these impacts and a significant increase in scientific research, we still lack critical information about the etiology and ecology for most of the ~20 described coral diseases [4–6]. The need for a better understanding of coral diseases has escalated with an increasing PLOSONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 1 / 16 OPEN ACCESS Citation: Gignoux-Wolfsohn SA, Vollmer SV (2015) Identification of Candidate Coral Pathogens on White Band Disease-Infected Staghorn Coral. PLoS ONE 10(8): e0134416. doi:10.1371/journal.pone.0134416 Editor: Christian R Voolstra, King Abdullah University of Science and Technology, SAUDI ARABIA Received: April 17, 2015 Accepted: July 8, 2015 Published: August 4, 2015 Copyright: © 2015 Gignoux-Wolfsohn, Vollmer. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: Sequences from this study have been deposited to the Short Read Archive (SRA) database under accession numbers SRR2078055-SRR2078108. Funding: Supported by National Science Foundation grant to SVV (OCE 0751666). Competing Interests: The authors have declared that no competing interests exist. amount of data tying the rise in coral disease prevalence and increased pathogen virulence to warming ocean temperatures [2, 7]. A major roadblock for coral disease research is the difficulty of isolating and culturing coral disease pathogens [8, 9]. As a result, the discovery of putative pathogens has relied heavily on identifying bacteria that are strongly associated with diseases using genetic techniques such as clone-based 16S rRNA gene sequencing [10–23] and, more recently, high-throughput 16S rRNA gene sequencing and high-throughput microarrays [24–29]. High-throughput 16S rRNA gene sequencing of the coral microbiome has revealed a higher diversity of bacteria than previously thought; in a survey of 16S gene sequencing studies across seven Caribbean coral species, Sunagawa et al. (2009) predict that each individual coral harbors several thousand operational taxonomic units (OTUs). This high diversity makes identifying putative pathogens in the coral microbiome more difficult. One of the most destructive coral diseases to date is white band disease (WBD), a host-spe- cific disease that affects the two Caribbean acroporid species: Acropora cervicornis (staghorn coral) and A. palmata (elkhorn coral). Since it was first observed in 1979 [30], WBD has caused unprecedented Caribbean-wide mass die-offs of these critical reef-building species [31], result- ing in the recent listing of both species as endangered under the US Endangered Species Act [32]. WBD is infectious and can be transmitted by direct contact between corals, through the water column to an injured coral, and by the corallivorous snail Coralliophila abbreviata [33, 34]. Previous work confirms that WBD is caused by a bacterial pathogen [35, 36] and multiple putative pathogens have been identified [17, 36–38]. Ritchie and Smith (1998) isolated a strain of Vibrio from WBD-infected A. cervicornis that was similar to Vibrio charchariae in both metabolism and morphology [37, 39] and Gil-Agudelo et al. (2006) were then able to elicit WBD signs in a healthy coral with a putative pathogen similar to V. charchariae [38]. Sweet et al. (2014) used a combination of culture independent and culture dependent antibiotic experiments to identify three candidate WBD pathogens: V. charchariae, Lactobacillus suebi- cus, and Bacillus sp. Casas et al. (2004) used culture-independent 16S rRNA sequences to iden- tify a novel Rickettsiales-like bacterium associated with A. cervicornis fragments that were collected after the outbreak of WBD, but which was absent from museum samples collected prior to the outbreak. Because independent studies have identified different putative WBD pathogens, it is possible that multiple pathogens (either singularly or in combination) could elicit WBD signs. In this study, we used Illumina 16S rRNA gene sequencing to compare the bacterial com- munities of healthy and diseased (WBD infected) A. cervicornis collected in the field from four sites in two different years. We then conducted tank-based infection experiments to identify differences in the bacterial communities of infected, exposed but asymptomatic, and healthy control corals, and compared these data to the two years of field data. Non-metric multidimen- sional scaling (nMDS) and PERMANOVA were used to characterize community-level changes in the coral microbiome due to disease state, site, and year. Multi-factor negative binomial gen- eralized linear models (GLMs) were then used to quantify significant changes in individual OTU abundances between diseased and healthy corals in the field and tank datasets. Those OTUs that were strongly and consistently associated with disease in both datasets are the most likely WBD pathogens. Materials and Methods Field collections Collection permits were provided by Autoridad Nacional del Ambiente (ANAM#SE/A-1-12) for sampling of the protected species Acropora cervicornis. Seventy-nine one cm fragments of White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 2 / 16 A. cervicornis (30 healthy and 49 diseased) were collected from the field in the summers of 2009 and 2010 from four sites in Coral Cay, Bocas del Toro, Panama approximately 500 m apart. WBD interfaces were tagged with cable ties prior to collection and only samples with actively progressing WBD were sampled from the field. Diseased coral samples were cut at the interface of living tissue and dead skeleton. Healthy samples were taken from completely asymptomatic coral colonies. Corals were transported from the field in separate containers and placed in one ml of DNA buffer for preservation [40]. Seventy-nine samples were extracted: 49 diseased and 30 healthy. Numbers of corals collected from each site are available in S1 Table. Tank-based infection experiment In February of 2012, 36 healthy five cm fragments of A. cervicornis from six colonies were col- lected, transported back to the wet lab at the Smithsonian Tropical Research Institute, and cable-tied to plastic louver. One fragment from each colony (six total fragments/tank) was ran- domly placed in six flow-through 20 L aquaria with a koralia nano powerhead (Hydor USA Inc., Sacramento, CA, USA) to acclimate for one day. A disease homogenate was made by first vortexing six five cm coral fragments with active WBD signs in separate falcon tubes with glass beads and 15 mL filtered seawater (after Kline and Vollmer 2011) and then pooling together the separate homogenates. A healthy (control) homogenate was made in the same manner using coral fragments from colonies that did not show signs of disease. Flow was stopped and three tanks were each dosed with 30 mL of diseased coral homogenate and the other three were dosed with 30 mL of the healthy homogenate. Healthy coral fragments were then monitored every two hours for disease signs. As infected corals exhibited signs of WBD (after 40 hours), they were removed from the experimental tanks and one cm of coral tissue at the disease inter- face was preserved in DNA buffer. Healthy fragments were all sampled on day four of the experiment. Number of corals infected in each tank is available in S2 Table. Total DNA was extracted from 19 fragments from this experiment: seven dosed with disease homogenate and contracted WBD (DD), seven were dosed with healthy homogenate and remained healthy (HH), and five were dosed with disease homogenate but remained healthy or asymptomatic (DH). 16S library preparation DNA was extracted from samples preserved in guanidine thiocyanate DNA buffer [40] using the Agencourt DNAdvance bead extraction kit (Agencourt Bioscience Corporation, Beverly, MA, USA) a blank DNA extraction was performed with each round of extractions. The V6 hypervariable region of the ribosomal small subunit 16S gene was chosen as the target due to its short length but high sensitivity to diversity, making it a good candidate for Illumina sequencing which has short read lengths but high sequencing depth [41–43]. The V6 region was amplified with custom barcoded primers that consist of a region that anneals to the V6 region of interest, followed by a unique five basepair barcode, and the Illumina sequencing adapter [44]: V6-L [5’-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTnnnnnACRACAC GAGCTGACGAC-3’] V6-R [5’-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTnnnnnACRACAC GAGCTGACGAC-3’] Barcodes differed by two or more basepairs to reduce incorrect barcode calling. A separate, 40 μl PCR reaction for each sample was performed with a unique combination of primers: 5 μl each 4mM primer, 8μl standard Taq buffer (New England Biolabs, Ipswich, MA, USA), 0.8μl dNTPs, 20 μl diH20, 0.5 μl Taq DNA polymerase (NEB) for the following cycle: 94°C for 2m, White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 3 / 16 28 cycles of: 94°C for 15s, 55°C for 15s, 72°C for 30s, followed by 72°C for 1m. A negative control and blank was amplified with each set of reactions. PCR reactions were pooled and amplified with the Illumina primers: OLJ139[5’AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGA3’] OLJ140 [5’CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATT CCTGCTGAAC3’] in a 40 μl reaction: 8 μl Phusion buffer (NEB) 0.8 μl dNTPs, 0.5 μl Phusion HIfidelity Taq (NEB), 20.2 μl diH20, 0.5 μl DNA (previous PCR product), for the following cycle: 98°C for 2m, 12 cycles of: 98°C for 1m, 55°C for 1m, 72°C for 1m, and finally 72°C for 5m. Final PCR products were cleaned using the DNAmpure beads (Agencourt), concentration and length were verified using the Agilent 2100 Bioanalyzer system (Agilent, Santa Clara, CA, USA) and sequenced using paired-end 150 basepair sequencing on the Illumina Hiseq 2000 at Tufts University. Bioinformatics Paired reads were overlapped using FLASH [45]. Basepairs with a Phred scoreF) Disease_state 1 3.22 3.22 10.96 0.10 0.001 Site 3 3.78 1.26 4.27 0.12 0.001 Year 1 0.617 0.62 2.09 0.019 0.011 Disease_state:Site 3 1.60 0.53 1.81 0.05 0.001 Disease_state:Year 1 0.68 0.68 2.32 0.022 0.005 Site:Year 3 1.74 0.58 1.98 0.06 0.001 Residuals 64 18.83 0.29 NA 0.60 NA Total 78 31.13 NA NA 1 NA doi:10.1371/journal.pone.0134416.t002 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 5 / 16 of the effects of site and disease state on the bacterial communities as demonstrated by PER- MANOVA, the differences are most likely due to the reduction in dimensional space by nMDS. On the nMDS plot, diseased and healthy corals separated along nMDS1 while corals sepa- rated by site along nMDS2 (Fig 1A). PERMANOVA and nMDS analyses using presence/ absence data (not shown) gave the same results as the abundance data, indicating that signifi- cance was not driven solely by differences in abundance of OTUs. To further explore the strength of the effects of site on diseased and healthy corals, we split the data from diseased and healthy corals and ran two separate PERMANOVAs. These PER- MANOVAs indicated that site had a larger effect on the bacterial communities of healthy corals (R2 = 0.28, p = 0.001, Table 3) than on those of diseased corals (R2 = 0.13, p = 0.001, Table 4). PERMANOVA on the dataset from tank-exposed corals also indicated a significant effect of disease state (R2 = 0.29, p = 0.007), which was supported by the nMDS plot, where diseased and healthy corals separated along nMDS1 (Fig 1B). Interestingly, the corals that were exposed Fig 1. nMDS plots of dissimilarities between samples (a) Field collection samples, showing clustering according to disease state. “Healthy” “Diseased” and site names denote the centroids of each group and ellipses are 95% confidence ellipses. (b) Tank-exposed samples, showing clustering according to disease state. “Healthy” and “Diseased” labels denote the centroids of each disease state and ellipses are 95% confidence ellipses. doi:10.1371/journal.pone.0134416.g001 Table 3. Results of PERMANOVA based on Bray-Curtis dissimilarities of the relative abundance of OTUs on field-collected healthy A. cervicornis in response to site and year. Df SumsOfSqs MeanSqs F.Model R2 Pr(>F) Site 3 2.80 0.93 3.69 0.28 0.001 Year 1 0.54 0.54 2.13 0.054 0.041 Site:Year 2 0.73 0.37 1.45 0.074 0.10 Residuals 23 5.82 0.25 NA 0.58 NA Total 29 9.89 NA NA 1 NA doi:10.1371/journal.pone.0134416.t003 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 6 / 16 to disease but remained asymptomatic (DH) clustered more closely on the nMDS plot with healthy (HH) corals than diseased (DD) corals. The negative binomial GLM on the field data comparing the abundance of OTUs across dis- ease state and year identified 1,363 individual OTUs that differed significantly due to disease state, 20 OTUs that differed significantly due to year, and 66 OTUs that differed significantly due to the interaction of disease state and year (Table 5). The majority of the OTUs that dif- fered due to disease state (1,012 or 74%) were significantly more abundant on diseased corals than healthy corals (Fig 2A). In the tank-infected corals, the negative binomial GLM compar- ing disease-exposed corals that contracted disease (DD) with healthy-exposed (i.e. control) cor- als (HH) identified 521 OTUs associated with disease state, the majority of which (n = 494; 95%) were more abundant on the disease-infected corals (Fig 2B). By comparing disease and healthy-associated OTUs in the field-collected dataset to those in the tank-exposed dataset, we identified 106 consistently disease-associated OTUs (i.e. more abundant in diseased corals) and 16 consistently healthy-associated OTUs (i.e. more abundant in healthy corals) and classified them by order (Fig 3). We further narrowed the list of consis- tently disease- or healthy-associated OTUs by dividing them into two tiers: tier 1 consists of those OTUs that differed significantly by disease state but not by site or year, and tier 2 consists of those OTUs that differed by disease state as well as by site or year (i.e. were significantly dif- ferent in the DESeq model ~disease state:site or ~disease state:year). We identified 12 tier 2 OTUs: seven associated with diseased corals and two associated with healthy corals. Disease- associated tier 2 OTUs consisted of seven OTUs that differed by year (two belonging to Flavo- bacteriales, two Rhodobacterales, one Alteromonadales, one Oceanospirillales, one unidentified) and two OTUs that differed by both year and site (one belonging to the phylum Tenericutes and one unidentified). Healthy-associated tier 2 OTUs consisted of two OTUs that differed by site (belonging to the orders Burkholderales and Pseudomonadales) and one OTU that differed by both year and site (Saprospirales). Table 4. Results of PERMANOVA based on Bray-Curtis dissimilarities of the relative abundance of OTUs on field-collected diseased A. cervicornis in response to site and year. Df SumsOfSqs MeanSqs F.Model R2 Pr(>F) Site 3 2.35 0.78 2.40 0.13 0.001 Year 1 0.79 0.78 2.41 0.042 0.001 Site:Year 3 1.36 0.46 1.39 0.074 0.018 Residuals 43 14.04 0.33 NA 0.76 NA Total 50 18.54 NA NA 1 NA doi:10.1371/journal.pone.0134416.t004 Table 5. Significantly associated OTUs in tank and field-collected datasets. Dataset Factor Level Significantly associated OTUs Field Disease state 1,363 Diseased 1,012 (74%) Healthy 351 (26%) Year 20 Disease state * Year 66 Tank Disease State 521 Diseased 494 (95%) Healthy 27 (5%) doi:10.1371/journal.pone.0134416.t005 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 7 / 16 The five bacterial orders with the greatest number of disease-associated OTUs in tier 1 were: Flavobacteriales with 27 OTUs, Alteromonadales with 13 OTUs, Oceanospirillales with eight OTUs, Campylobacterales with seven OTUs, and Rhodobacterales with four OTUs (Fig 3). The three bacterial orders with multiple healthy-associated OTUs were: Flavobacteriales with four OTUs and Stramenopiles with two OTUs. Complete taxonomic information for all significantly different OTUs can be found in S3 Table. Discussion When Acropora cervicornis is infected with white band disease, its microbiome changes drasti- cally, with an increase in hundreds of disease-associated OTUs, rather than just a few potential pathogens. The shift from a healthy to a diseased coral microbiome was marked by elevated microbial diversity and richness, a pattern that is consistent across other coral diseases [14, 19, 23–25, 28, 50]. We also detected strong site-specific variation in the microbiomes of all corals. Interestingly, the site-specificity of the bacterial communities was strongest on healthy corals, and thus contraction of WBD appears to reduce this site specificity. Because we identified a large number of disease-associated OTUs, the observed differences in the bacterial communi- ties of diseased and healthy corals are not likely the results of a change in the abundance of a single primary pathogen, but are also due to changes in opportunistic pathogens, secondary colonizers, and saprophytic bacteria. Many of the OTUs that are more abundant on diseased corals are also present on healthy corals. This could be because some apparently ‘healthy’ corals are asymptomatic, but harbor subclinical infections of disease-causing bacteria. Alternatively, these OTUs may be ‘pathobionts’[51]: microbes that are present on the host but become patho- genic in certain hosts due to environmental conditions or host susceptibility. In all, we identi- fied 97 consistently disease-associated bacteria across space and time belonging to 17 different orders of bacteria; the most abundant and noteworthy are discussed below. Flavobacteriales made up the largest percentage (27 OTUs, 27%) of our disease-associated OTUs and are therefore likely involved in the WBD etiology. Flavobacteria are well-known pathogens of fish [52, 53]. White band disease shares some notable characteristics with flavo- bacterial diseases in fish. Two common flavobacterial fish pathogens, Flavobacteria psychrophi- lum and F. columnaris, both cause open lesions and tissue necrosis [52–54], similar to WBD. Furthermore, infection of salmonids with F. columnaris can be characterized by simultaneous Fig 2. Plots of the log2 fold abundance change of each OTU by the mean of normalized counts. Significantly more or less abundant OTUs are in red (a) Field-collected corals by year + disease state (b) Tank-exposed corals by final disease state. doi:10.1371/journal.pone.0134416.g002 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 8 / 16 infection with other strains of Flavobacteria [55], suggesting that one of the 27 WBD-associ- ated Flavobacteriales OTUs identified here may be the primary pathogen. The similarities between WBD and columnaris disease are strengthened by our finding that Pseudomonadales, which is an antagonist of F. columnaris [55], was consistently associated with healthy corals. Lower abundances of Pseudomonadales in an initially healthy coral may allow strains of Flavo- bacteria to infect and proliferate and thereby cause disease. If the etiology of WBD is in fact Fig 3. Taxonomic classification on the level of order of OTUs that are significantly more or less abundant in diseased corals compared to healthy across both tank-exposed and field-collected corals. Tier 1 consists of those OTUs that did not differ significantly across site and year, tier 2 consists of OTUs that differed significantly due to disease state and site and/or year. doi:10.1371/journal.pone.0134416.g003 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 9 / 16 similar to that of columnaris disease, then one of the 27 Flavobacteriales OTUs that are associ- ated with WBD may be a keystone pathogen. Keystone pathogens cause shifts in the natural bacterial community of their host, which lead to a diseased state, making it harder to detect the primary pathogen [56, 57]. Because Flavobacteriales are also found on healthy corals, they may be pathobionts or opportunistic pathogens. In addition, multiple strains of Flavobacteriales may elicit the same characteristic disease signs in A. cervicornis, or they may work together to cause WBD. Understanding the time-course of infection with strains of Flavobacteriales will help to elucidate what roles the different flavobacterial species are playing in the diseased coral. Flavobacteria have been largely overlooked as potential pathogens in coral diseases, yet species of Flavobacteria have been previously associated with both black band disease and white plague disease [10, 22, 24, 58]. Flavobacteria may therefore be more important in coral disease as a whole than previously thought. The next most abundant orders of disease-associated OTUs—Alteromonadales (13 OTUs), Oceanospirillales (eight OTUs), Campylobacterales (eight OTUs), and Rhodobacterales (four OTUs)—are not likely candidates for a primary WBD pathogen. While they have all been asso- ciated with corals and in some cases coral diseases, none of these orders include well-character- ized coral pathogens, but instead seem to play either a beneficial, opportunistic, or secondary role in the diseased coral. Alteromonadales have been associated with both white plague disease [24, 25], and yellow band disease [19], but have also been identified as “resident” coral bacteria [59–62]. The only known pathogen in this order is Thalassomonas loyana, the causative agent of a white plague-like disease, but members of the Alteromonadales order are not well-known pathogens in other animals [63]. Members of the order Oceanospirillales have not been previ- ously associated with any coral or other animal diseases [4, 64–66], but have been recently been shown to be commonly associated with corals potentially as beneficial symbionts [50, 67]. Some members of Oceanospirillales are well-known for their role in the bacterial bloom follow- ing the Deepwater Horizon oil spill [68, 69] and their ability to degrade Dimethylsulfoniopro- pionate, hydrocarbons, and amino acids [70–72]. Members the order Campylobacterales are zoonotic pathogens which are commensal in marine mammals and birds [73, 74]. While strains of Campylobacterales have been associated with coral diseases previously, including black band disease [10], white syndrome, brown band disease [21], and white plague [24], their role in the etiologies of these diseases remains unclear. Given that Campylobacter are frequently found in sewage [75], they may be introduced to the coral microbiome via human sewage deposition into the ocean. Rhodobacteraceae, our fifth most common disease-associated order, have also been associated with many coral diseases in multiple species across a variety of loca- tions [4, 24, 25, 76], but have not been identified as a pathogen in corals or other animals. One of the six disease-associated Rhodobacteraceae identified here was present in every diseased and healthy coral sampled across both datasets, but increased in abundance on diseased corals, similar to previously described changes in abundance of strains of Rhodobacter in response to disease in other corals [24]. The disease-associated OTUs belonging to these four orders are likely either 1) secondary opportunistic colonizers, which take advantage of a diseased coral’s weakened state [24], 2) beneficial symbionts, which increase in an effort to combat the primary pathogen, or 3) saprophytic bacteria, which are attracted to the increased nutrients of a dying coral. In addition to these bacterial orders with multiple disease-associated OTUs, we identified two previously proposed WBD pathogens among the disease-associated OTUs: one belonging to the family Vibrionaceae and one to Rickettsiaceae. Species of Vibrio have been confirmed as pathogens in other coral diseases (Cervino et al. 2008, Ushijima et al. 2012), most notably V. corallilyticus in Pocillopora damicornis tissue lysis [77]. Vibrios are of special interest as patho- gens given their well-characterized role in human diseases such as cholera [78]. Ritchie and White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 10 / 16 Smith (1998) first isolated a strain of bacteria from diseased corals that was identified as Vibrio charchariae through morphological and metabolic methods. Gil-Agudelo et al. (2006) were then able to isolate and genetically identify a strain of Vibrio charchariae from diseased corals in Puerto Rico, which elicited signs similar to WBD in healthy corals [36, 38]. While more research is needed to confirm the relationship of the strain identified here to Vibrio charchar- iae, our identification of a consistently white band disease-associated Vibrio using culture- independent methods supports the findings of these previous studies. We also identified five unclassified gammaproteobacteria associated with diseased corals, which may be Vibrio and warrant further investigation. Members of the order Rickettsiales are well-characterized pathogens in marine invertebrates [79]. As obligate intracellular parasites, pathogenicity of Rickettsia can only be determined using genetic or histological methods, not in culture [80]. Rickettsia-like organisms have been associated with diseased Caribbean acroporids in both histological and genetic studies [17, 81]. Casas et al. (2004) identified a coral-associated Rickettsiales sequence (called CAR-1a) on A. cervicornis collected after the outbreak of WBD, which was absent on museum specimens pre- dating disease. CAR-1a was common on both diseased and healthy A. cervicornis, suggesting that it is likely an opportunistic pathogen, which only becomes pathogenic under certain con- ditions. Similarly in our study, Rickettsiaceae was found on more than 90% of all A. cervicornis both from the field (92% on healthy; 97% on diseased) and tanks (100% of corals). While more information is needed to determine if the Rickettsiaceae observed here is the previously detected CAR-1a strain, it does display similar patterns of abundance. Given the large number of WBD-associated OTUs, including two previously suggested putative pathogens as well as many strains of Flavobacteria, we should consider the possibility that multiple bacterial species could elicit WBD signs either singularly or as a consortium. Coral diseases such as yellow band disease and black band disease are caused by a consortium of bacteria [22, 82]. In WBD, multiple disease-associated bacteria may be able to cause disease signs in slightly different combinations. Alternatively, one or more of these putative pathogens may actually be secondary colonizers, bacteria that are only able to colonize the host after the primary colonizer (or pathogen) has infected and altered the host environment. When looking at other factors that contribute to coral microbiome variability, we found that site had as large an effect on the composition of the coral microbiome as disease. While the collection sites were only two to six km apart, this finding is similar to the effects of site on the bacterial communities of other species of coral [25, 27, 28, 50, 83, 84]. Interestingly, we found that site had an effect on both healthy and diseased coral bacterial communities. How- ever, site had less of an effect on diseased coral-associated bacterial communities, indicating that WBD reduces the natural site-specificity of coral-associated bacteria. We identified 5 OTUs in our list of disease- or healthy-associated OTUs that differed due to site and disease state belonging to the orders: Burkholderales, Pseudomonadales, Saprospirales, Tenericutes, and unidentified bacteria. Further investigation into OTUs that differ due to disease and site will require larger sample sizes from each site. The site-specific variation of diseased coral-associ- ated bacteria is likely complicating our search for primary coral disease pathogens. In examining WBD-associated bacterial communities, we have identified multiple previ- ously proposed WBD pathogens, and propose strains of Flavobacteriales as new putative WBD pathogens. Further work should examine the possibility that multiple strains are involved in causing WBD. To separate the cause of the disease from the effects, the timing of colonization of diseased corals by the disease-associated bacteria must be examined. While culturing of pathogens is still required to confirm etiology, this culture-independent genetic analysis of dis- eased individuals will greatly inform future culture-based experiments. Understanding diseased and healthy bacterial communities on lower-level organisms such as corals can aid our White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 11 / 16 understanding of more complex bacterial communities such as those in the human gut. Ulti- mately, a better characterization of coral-associated bacterial communities will inform our quest to understand and mitigate the current rise in coral diseases. Supporting Information S1 Table. Number of corals collected from each site. (DOCX) S2 Table. Infection rate for corals in tank-based infection experiment. (DOCX) S3 Table. Significantly different OTUs between diseased and healthy for the field and tank datasets. (XLSX) Acknowledgments We would like to thank members of the Vollmer lab and the Three Seas program for help with sample collection, especially F. Aronson, S. Libro, and E. Hemond; G. Gloor and D. Carter for providing barcodes and PCR troubleshooting; T. Gouhier for help with statistical analyses; E. Holum for help with Bioinformatics; J. Davidson and K. Wiggin for help with analyses; and M. Garren, R. Certner, F. Aronson, and S. Kopac for valuable comments on the manuscript. Author Contributions Conceived and designed the experiments: SVV SAGW. Performed the experiments: SVV SAGW. Analyzed the data: SAGW. Wrote the paper: SAGW SVV. References 1. Harvell CD, Aronson RB, Baron N, Connell J, Dobson AP, Ellner SP, et al. The rising tide of ocean dis- eases: unsolved problems and research priorities. Frontiers in Ecology and the Environment. 2004; 2 (7):375–82. 2. Harvell CD, Kim K, Burkholder JM, Colwell RR, Epstein PR. Emerging Marine Diseases: Climate Links and Anthropogenic Factors. Science. 1999; 285:1505–10. PMID: 10498537 3. Goreau TJ, Cervino JM, Goreau M, Hayes RL, Hayes M, Richardson LL, et al. Rapid spread of dis- eases in Caribbean coral reefs. Revista de Biologica Tropical. 1998; 46:157–71. 4. Mouchka ME, Hewson I, Harvell CD. Coral-associated bacterial assemblages: current knowledge and the potential for climate-driven impacts. Integrative and comparative biology. 2010; 50(4):662–74. Epub 2011/05/12. doi: 10.1093/icb/icq061 PMID: 21558231. 5. Lesser MP, Bythell JC, Gates RD, Johnstone RW, Hoegh-Guldberg O. Are infectious diseases really killing corals? Alternative interpretations of the experimental and ecological data. Journal of Experimen- tal Marine Biology and Ecology. 2007; 346(1–2):36–44. doi: 10.1016/j.jembe.2007.02.015 6. Sutherland KP, Porter JW, Torres C. Disease and immunity in Caribbean and Indo-Pacific zooxanthel- late corals. Marine Ecology Progress Series. 2004; 266:273–302. 7. Burge CA, Mark Eakin C, Friedman CS, Froelich B, Hershberger PK, Hofmann EE, et al. Climate change influences on marine infectious diseases: implications for management and society. Annual review of marine science. 2014; 6:249–77. Epub 2013/07/03. doi: 10.1146/annurev-marine-010213- 135029 PMID: 23808894. 8. Richardson LL. Coral diseases: what is really known? Trends in Ecology & Evolution. 1998; 13(11). 9. Rosenberg E, Koren O, Reshef L, Efrony R, Zilber-Rosenberg I. The role of microorganisms in coral health, disease and evolution. Nature reviews Microbiology. 2007; 5(5):355–62. Epub 2007/03/27. doi: 10.1038/nrmicro1635 PMID: 17384666. White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 12 / 16 10. Frias-Lopez J, Zerkle AL, Bonheyo GT, Fouke BW. Partitioning of Bacterial Communities between Sea- water and Healthy, Black Band Diseased, and Dead Coral Surfaces. Applied and environmental micro- biology. 2002; 68(5):2214–28. doi: 10.1128/aem.68.5.2214–2228.2002 PMID: 11976091 11. Barneah O, Ben-Dov E, Kramarsky-Winter E, Kushmaro A. Characterization of black band disease in Red Sea stony corals. Environmental microbiology. 2007; 9(8):1995–2006. Epub 2007/07/20. doi: 10. 1111/j.1462-2920.2007.01315.x PMID: 17635545. 12. Sato Y, Willis BL, Bourne DG. Successional changes in bacterial communities during the development of black band disease on the reef coral, Montipora hispida. The ISME journal. 2010; 4(2):203–14. Epub 2009/09/25. doi: 10.1038/ismej.2009.103 PMID: 19776765. 13. Sekar R, Mills DK, Remily ER, Voss JD, Richardson LL. Microbial communities in the surface muco- polysaccharide layer and the black band microbial mat of black band-diseased Siderastrea siderea. Applied and environmental microbiology. 2006; 72(9):5963–73. Epub 2006/09/08. doi: 10.1128/AEM. 00843-06 PMID: 16957217; PubMed Central PMCID: PMC1563687. 14. Pantos O, Cooney RP, Le Tissier M, O'Donell AG, Bythell J. The Bacterial Ecology of a plague-like dis- ease affecting the caribbean coral Montastrea annularis. Environmental microbiology. 2003; 5(5):370– 82. PMID: 12713463 15. de Castro AP, Araujo SD Jr., Reis AM, Moura RL, Francini-Filho RB, Pappas G Jr., et al. Bacterial com- munity associated with healthy and diseased reef coral Mussismilia hispida from eastern Brazil. Micro- bial ecology. 2010; 59(4):658–67. Epub 2010/03/31. doi: 10.1007/s00248-010-9646-1 PMID: 20352207. 16. Frias-Lopez J, Klaus JS, Bonheyo GT, Fouke BW. Bacterial community associated with black band dis- ease in corals. Applied and environmental microbiology. 2004; 70(10):5955–62. Epub 2004/10/07. doi: 10.1128/AEM.70.10.5955–5962.2004 PMID: 15466538; PubMed Central PMCID: PMC522118. 17. Casas V, Kline DI, Wegley L, Yu Y, Breitbart M, Rohwer F. Widespread association of a Rickettsiales- like bacterium with reef-building corals. Environmental microbiology. 2004; 6(11):1137–48. Epub 2004/ 10/14. doi: 10.1111/j.1462-2920.2004.00647.x PMID: 15479247. 18. Cook GM, Rothenberger JP, Sikaroodi M, Gillevet PM, Peters EC, Jonas RB. A comparison of culture- dependent and culture-independent techniques used to characterize bacterial communities on healthy and white plague-diseased corals of the Montastraea annularis species complex. Coral Reefs. 2013; 32(2):375–88. doi: 10.1007/s00338-012-0989-6 19. Croquer A, Bastidas C, Elliott A, Sweet M. Bacterial assemblages shifts from healthy to yellow band dis- ease states in the dominant reef coral Montastraea faveolata. Environ Microbiol Rep. 2013; 5(1):90–6. Epub 2013/06/13. doi: 10.1111/j.1758-2229.2012.00397.x PMID: 23757136. 20. Kimes NE, JohnsonWR, Torralba M, Nelson KE, Weil E, Morris PJ. The Montastraea faveolata micro- biome: ecological and temporal influences on a Caribbean reef-building coral in decline. Environmental microbiology. 2013. Epub 2013/06/12. doi: 10.1111/1462-2920.12130 PMID: 23750924. 21. Sweet M, Bythell J. Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef-building corals. Environmental microbiology. 2012; 14(8):2184–99. Epub 2012/ 04/18. doi: 10.1111/j.1462-2920.2012.02746.x PMID: 22507379; PubMed Central PMCID: PMC3465780. 22. Cooney RP, Pantos O, Tissier M, Barer MR, O'Donell AG, Bythell JC. Characterization of the bacterial consortium associated with black band disease in coral using molecular microbiological techniques. 4. 2002;7:401–13. 23. Closek CJ, Sunagawa S, DeSalvo MK, Piceno YM, DeSantis TZ, Brodie EL, et al. Coral transcriptome and bacterial community profiles reveal distinct Yellow Band Disease states in Orbicella faveolata. The ISME journal. 2014. Epub 2014/06/21. doi: 10.1038/ismej.2014.85 PMID: 24950107. 24. Sunagawa S, DeSantis TZ, Piceno YM, Brodie EL, DeSalvo MK, Voolstra CR, et al. Bacterial diversity andWhite Plague Disease-associated community changes in the Caribbean coral Montastraea faveo- lata. The ISME journal. 2009; 3(5):512–21. Epub 2009/01/09. doi: 10.1038/ismej.2008.131 PMID: 19129866. 25. Roder C, Arif C, Daniels C, Weil E, Voolstra CR. Bacterial profiling of White Plague Disease across cor- als and oceans indicates a conserved and distinct disease microbiome. Molecular ecology. 2014; 23:965–74. doi: 10.1111/mec.12638 PMID: 24350609 26. Cardenas A, Rodruiguez-R LM, Pizarro V, Cadavid LF, Arevalo-Ferro C. Shifts in bacterial communities of two caribbean reef-building coral species affected by white plague disease. The ISME journal. 2012; 6:502–12. doi: 10.1038/ismej.2011.123 PMID: 21955993 27. Garcia GD, Gregoracci GB, Santos Ede O, Meirelles PM, Silva GG, Edwards R, et al. Metagenomic analysis of healthy and white plague-affected Mussismilia braziliensis corals. Microbial ecology. 2013; 65(4):1076–86. Epub 2013/01/15. doi: 10.1007/s00248-012-0161-4 PMID: 23314124. White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 13 / 16 28. Apprill A, Hughen K, Mincer T. Major similarities in the bacterial communities associated with lesioned and healthy Fungiidae corals. Environmental microbiology. 2013; 15(7):2063–72. Epub 2013/03/23. doi: 10.1111/1462-2920.12107 PMID: 23516962. 29. Lesser MP, Jarett JK. Culture Dependent and Independent Analyses Reveal No Prokaryotic Commu- nity Shifts or Recovery of Serratia marcescens in Acropora palmata with White Pox Disease. FEMS microbiology ecology. 2014. Epub 2014/03/07. doi: 10.1111/1574-6941.12311 PMID: 24597458. 30. Gladfelter WB. White-band disease in Acropora palmata: implications for the structure and growth of shallow reefs. Bulletin of Marine Science. 1982; 32(2):639–43. 31. Aronson RB, Precht WF. White-band disease and the changing face of Caribbean coral reefs. Hydro- biologia. 2001; 460:25–38. 32. Endangered and Threatened Wildlife and Plants: Final Listing Determinations on Proposal to List 66 Reef-building Coral Species and to Reclassify Elkhorn and Staghorn Corals., (2014). 33. Gignoux-Wolfsohn SA, Marks CJ, Vollmer SV. White Band Disease transmission in the threatened coral, Acropora cervicornis. Scientific reports. 2012; 2:804. Epub 2012/11/15. doi: 10.1038/srep00804 PMID: 23150775; PubMed Central PMCID: PMC3496162. 34. Vollmer SV, Kline DI. Natural Disease Resistance in Threatened Staghorn Corals. Plos one. 2008; 3( 11). doi: 10.1371/journal.pone.0003718.g001 35. Kline DI, Vollmer SV. White Band Disease (type I) of endangered caribbean acroporid corals is caused by pathogenic bacteria. Scientific reports. 2011; 1:7. Epub 2012/02/23. doi: 10.1038/srep00007 PMID: 22355526; PubMed Central PMCID: PMC3216495. 36. Sweet MJ, Croquer A, Bythell JC. Experimental antibiotic treatment identifies potential pathogens of white band disease in the endangered Caribbean coral Acropora cervicornis. Proceedings Biological sciences / The Royal Society. 2014; 281(1788). Epub 2014/06/20. doi: 10.1098/rspb.2014.0094 PMID: 24943374. 37. Ritchie KB, Smith GW. Type II White-Band Disease. Revista de Biologica Tropical. 1998; 46:199–203. 38. Gil-Agudelo DL, Smith GW, Weil E. The white band disease type II pathogen in Puerto Rico. Revista de Biologica Tropical. 2006; 54:59–67. 39. Ritchie KB, Smith G. Preferential carbon utilization by surface bacterial communities from water mass, normal, and white-band diseased Acropora cervicornis. Molecular Marine Biology and Biotechnology. 1995; 4(4):345–52. 40. Fukami H, Budd AF, Levitan DR, Jara J, Kersanach R, Knowlton N. Geographic Differences in Species Boundaries among Members of the Montatstraea Annularis Complex Based on Molecular and Morpho- logical Markers. Evolution; international journal of organic evolution. 2004; 58(2):324–37. PMID: 15068349 41. Youssef N, Sheik CS, Krumholz LR, Najar FZ, Roe BA, Elshahed MS. Comparison of species richness estimates obtained using nearly complete fragments and simulated pyrosequencing-generated frag- ments in 16S rRNA gene-based environmental surveys. Applied and environmental microbiology. 2009; 75(16):5227–36. Epub 2009/06/30. doi: 10.1128/AEM.00592-09 PMID: 19561178; PubMed Central PMCID: PMC2725448. 42. Barriuso J, Valverde JR, Mellado RP. Estimation of bacterial diversity using next generation sequenc- ing of 16S rDNA: a comparison of different workflows. BMC bioinformatics. 2011; 12:473. Epub 2011/ 12/16. doi: 10.1186/1471-2105-12-473 PMID: 22168258; PubMed Central PMCID: PMC3258296. 43. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME journal. 2012; 6 (8):1621–4. Epub 2012/03/10. doi: 10.1038/ismej.2012.8 PMID: 22402401; PubMed Central PMCID: PMC3400413. 44. Gloor GB, Hummelen R, Macklaim JM, Dickson RJ, Fernandes AD, MacPhee R, et al. Microbiome Pro- filing by Illumina Sequencing of Combinatorial Sequence-Tagged PCR Products. Plos one. 2010; 5 (10). doi: 10.1371/journal.pone.0015406.g001 45. Magoc T, Salzberg SL. FLASH: Fast Length Adjustment of Short Reads to Improve Genome Assem- blies. Bioinformatics. 2011; 27(21):2957–63. doi: 10.1093/bioinformatics/btr507 PMID: 21903629 46. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA, Turnbaugh PJ, et al. Global pat- terns of 16s rRNA diversity at a depth of millions of sequences per sample. PNAS. 2010; 108:4516–22. doi: 10.1073/pnas.1000080107 PMID: 20534432 47. DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, et al. Greengenes, a chimera- checked 16S rRNA gene database and workbench compatible with ARB. Applied and environmental microbiology. 2006; 72(7):5069–72. Epub 2006/07/06. doi: 10.1128/AEM.03006-05 PMID: 16820507; PubMed Central PMCID: PMC1489311. White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 14 / 16 48. Anders S, Huber W. Differential expression analysis for sequence count data. Genome biology. 2010; 11(R106). 49. Jari Oksanen FGB, Roeland Kindt, Pierre Legendre, Peter R. Minchin, R. B., O'Hara GLS, Peter Soly- mos, M. Henry H. Stevens and HeleneWagner vegan: Community Ecology Package. R package ver- sion 2.0–9. 2013. 50. Sere MG, Tortosa P, Chabanet P, Turquet J, Quod JP, Schleyer MH. Bacterial Communities Associ- ated with Porites White Patch Syndrome (PWPS) on ThreeWestern Indian Ocean (WIO) Coral Reefs. Plos one. 2013; 8(12):e83746. Epub 2014/01/07. doi: 10.1371/journal.pone.0083746 PMID: 24391819; PubMed Central PMCID: PMC3877091. 51. Chow J, Tang H, Mazmanian SK. Pathobionts of the gastrointestinal microbiota and inflammatory dis- ease. Current opinion in immunology. 2011; 23(4):473–80. Epub 2011/08/23. doi: 10.1016/j.coi.2011. 07.010 PMID: 21856139; PubMed Central PMCID: PMC3426444. 52. Bullock GL, Hsu TC, Shotts EBJ. Columnaris disease of fishes. US Fish andWildlife Publications. 1986;129. 53. Starliper CE. Bacterial coldwater disease of fishes caused by Flavobacterium psychrophilum. Journal of Advanced Research. 2011; 2(2):97–108. doi: 10.1016/j.jare.2010.04.001 54. Davis HS. A new bacterial disease of fresh-water fishes1922. 55. Tiirola M, Valtonen ET, Rintamki-Kinnunen P, Kulomaa MS. Diagnosis of flavobacteriosis by direct amplification of rRNA genes. Diseases of aquatic organisms. 2002; 51:93–100. PMID: 12363090 56. Hajishengallis G, Darveau RP, Curtis MA. The keystone-pathogen hypothesis. Nature reviews Microbi- ology. 2012; 10(10):717–25. Epub 2012/09/04. doi: 10.1038/nrmicro2873 PMID: 22941505; PubMed Central PMCID: PMC3498498. 57. Zwart MP, Daros JA, Elena SF. One is enough: in vivo effective population size is dose-dependent for a plant RNA virus. PLoS pathogens. 2011; 7(7):e1002122. Epub 2011/07/14. doi: 10.1371/journal.ppat. 1002122 PMID: 21750676; PubMed Central PMCID: PMC3131263. 58. Jones RJ, Bowyer J, Hoegh-Guldberg O, Blackall LL. Dynamics of a temperature-related coral disease outbreak. Marine Ecology Progress Series. 2004; 281:63–77. 59. Bourne DG, Munn CB. Diversity of bacteria associated with the coral Pocillopora damicornis from the Great Barrier Reef. Environmental microbiology. 2005; 7(8):1162–74. Epub 2005/07/14. doi: 10.1111/j. 1462-2920.2005.00793.x PMID: 16011753. 60. Ceh J, van Keulen M, Bourne DG. Intergenerational transfer of specific bacteria in corals and possible implications for offspring fitness. Microbial ecology. 2013; 65(1):227–31. Epub 2012/08/17. doi: 10. 1007/s00248-012-0105-z PMID: 22895828. 61. Allers E, Niesner C, Wild C, Pernthaler J. Microbes enriched in seawater after addition of coral mucus. Applied and environmental microbiology. 2008; 74(10):3274–8. Epub 2008/03/18. doi: 10.1128/AEM. 01870-07 PMID: 18344335; PubMed Central PMCID: PMC2394949. 62. Ritchie KB. Regulation of Microbial Populations by Coral Surface Mucus and Mucus-Associated Bacte- ria. Marine Ecology Progress Series. 2006; 322:1–14. 63. Thompson FL, Barash Y, Sawabe T, Sharon G, Swings J, Rosenberg E. Thalassomonas loyana sp. nov., a causative agent of the white plague-like disease of corals on the Eilat coral reef. Int J Syst Evol Microbiol. 2006; 56(Pt 2):365–8. Epub 2006/02/02. doi: 10.1099/ijs.0.63800–0 PMID: 16449441. 64. Morrow KM, Moss AG, Chadwick NE, Liles MR. Bacterial associates of two Caribbean coral species reveal species-specific distribution and geographic variability. Applied and environmental microbiology. 2012; 78(18):6438–49. Epub 2012/07/10. doi: 10.1128/AEM.01162-12 PMID: 22773636; PubMed Central PMCID: PMC3426691. 65. Rohwer F, Seguritan V, Azam F, Knowlton N. Diversity and distribution of coral-associated bacteria. Marine Ecology Progress Series. 2002; 243:1–10. 66. Sharp KH, Distel D, Paul VJ. Diversity and dynamics of bacterial communities in early life stages of the Caribbean coral Porites astreoides. The ISME journal. 2012; 6(4):790–801. Epub 2011/11/25. doi: 10. 1038/ismej.2011.144 PMID: 22113375; PubMed Central PMCID: PMC3309355. 67. Bayer T, Neave MJ, Alsheikh-Hussain A, Aranda M, Yum LK, Mincer T, et al. The Microbiome of the Red Sea Coral Stylophora pistillata is Dominated by Tissue-Associated Endozoicomonas Bacteria. Applied and environmental microbiology. 2013; 79(15). 68. Hazen TC, Dubinsky EA, DeSantis TZ, Andersen GL, Piceno YM, Singh N, et al. Deep-sea oil plume enriches indigenous oil-degrading bacteria. Science. 2010; 330(6001):204–8. Epub 2010/08/26. doi: 10.1126/science.1195979 PMID: 20736401. 69. Mason OU, Hazen TC, Borglin S, Chain PS, Dubinsky EA, Fortney JL, et al. Metagenome, metatran- scriptome and single-cell sequencing reveal microbial response to Deepwater Horizon oil spill. The White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 15 / 16 ISME journal. 2012; 6(9):1715–27. Epub 2012/06/22. doi: 10.1038/ismej.2012.59 PMID: 22717885; PubMed Central PMCID: PMC3498917. 70. Raina JB, Dinsdale EA, Willis BL, Bourne DG. Do the organic sulfur compounds DMSP and DMS drive coral microbial associations? Trends in microbiology. 2010; 18(3):101–8. Epub 2010/01/05. doi: 10. 1016/j.tim.2009.12.002 PMID: 20045332. 71. Raina JB, Tapiolas D, Willis BL, Bourne DG. Coral-associated bacteria and their role in the biogeo- chemical cycling of sulfur. Applied and environmental microbiology. 2009; 75(11):3492–501. Epub 2009/04/07. doi: 10.1128/AEM.02567-08 PMID: 19346350; PubMed Central PMCID: PMC2687302. 72. Jensen S, Duperron S, Birkeland NK, Hovland M. Intracellular Oceanospirillales bacteria inhabit gills of Acesta bivalves. FEMSmicrobiology ecology. 2010; 74(3):523–33. Epub 2010/11/04. doi: 10.1111/j. 1574-6941.2010.00981.x PMID: 21044098. 73. Stoddard R, Gulland F, Atwill E, Lawrence J, JAng S, Conrad P. Salmonella and Campylobacter spp. in Northern Elephant Seals, California. Emerging Infectious diseases. 2005; 11(12). 74. Lee M, Newell D. Invited Minireview: Campylobacter in Poultry: Filling an Eological Niche. Avian Dis- eases. 2006; 50(1). 75. Moreno Y, Botella S, Alonso JL, Ferrus M, Hernandez M, Hernandez J. Specific Detection of Arcobac- ter and Campylobacter Strains in Water and Sewage by PCR and Fluorescent in Situ Hybridization. Applied and environmental microbiology. 2003; 69(2). doi: 10.1128/AEM.69.2.1181–1186.2003 76. Roder C, Arif C, Bayer T, Aranda M, Daniels C, Shibl A, et al. Bacterial profiling of White Plague Dis- ease in a comparative coral species framework. The ISME journal. 2014; 8(1):31–9. Epub 2013/08/09. doi: 10.1038/ismej.2013.127 PMID: 23924783; PubMed Central PMCID: PMC3869008. 77. Ben-Haim Y. Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen of the coral Pocillopora damicornis. International Journal of Systematic and Evolutionary Microbiology. 2003; 53(1):309–15. doi: 10.1099/ijs.0.02402–0 78. Butler SM, Camilli A. Going against the grain: chemotaxis and infection in Vibrio cholerae. Nature reviews Microbiology. 2005; 3(8):611–20. Epub 2005/07/14. doi: 10.1038/nrmicro1207 PMID: 16012515; PubMed Central PMCID: PMC2799996. 79. Friedman CS, Andree KB, Beauchamp KA, Moore JD, Robbins TT, Shields JD, et al. Candidatus xeno- haliotis californiensis, a newly described pathogen of abalone, Haliotis spp., along the west coast of North America. International Journal of Systematic and Evolutionary Microbiology. 2000; 50:847–55. PMID: 10758896 80. Walker D. Rickettsiae. In: Baron S, editor. Medical Microbiology. Galveston (TX): University of Texas Medical Branch at Galveston; 1996. 81. Peters EC, Oprandy J, Yevich P. Possible Causal Agent of "White Band Disease" in Caribbean Acro- porid Corals. Journal of Invertebrate Pathology. 1983; 41:394–6. 82. Cervino JM, Thompson FL, Gomez-Gil B, Lorence EA, Goreau TJ, Hayes RL, et al. The Vibrio core group induces yellow band disease in Caribbean and Indo-Pacific reef-building corals. Journal of applied microbiology. 2008; 105(5):1658–71. Epub 2008/09/19. doi: 10.1111/j.1365-2672.2008.03871. x PMID: 18798767. 83. Littman RA, Willis BL, Pfeffer C, Bourne DG. Diversities of coral-associated bacteria differ with location, but not species, for three acroporid corals on the Great Barrier Reef. FEMS microbiology ecology. 2009; 68(2):152–63. Epub 2009/03/24. doi: 10.1111/j.1574-6941.2009.00666.x PMID: 19302548. 84. Kvennefors EC, Eugenia S, Ridgway T, Barnes AC, Hoegh-Guldberg O. Bacterial Communities of Two Ubiquitous Great Barrier Reef Corals Reveals Both Site- and Species-Specificity of Common Bacterial Associates. Plos one. 2010; 5(4). doi: 10.1371/journal.pone.0010401.g001 White Band Disease Bacterial Communities PLOS ONE | DOI:10.1371/journal.pone.0134416 August 4, 2015 16 / 16